ID: 946171951

View in Genome Browser
Species Human (GRCh38)
Location 2:217900785-217900807
Sequence GAGTGTGCCCTCAGTGTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 210}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946171951_946171953 -3 Left 946171951 2:217900785-217900807 CCATCCACACTGAGGGCACACTC 0: 1
1: 0
2: 3
3: 16
4: 210
Right 946171953 2:217900805-217900827 CTCAACAGTTACTGAATCAATGG 0: 1
1: 0
2: 2
3: 20
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946171951 Original CRISPR GAGTGTGCCCTCAGTGTGGA TGG (reversed) Intronic
900125804 1:1068536-1068558 GAGTGTGACCCCAGGGTGGGAGG - Intergenic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
901718575 1:11176656-11176678 CAGGGTGGCCTCAGTGTGGCTGG - Intronic
903887907 1:26551644-26551666 GAGCTTGCCCTCGGTCTGGAAGG - Exonic
904078845 1:27859213-27859235 GCATGTGCCCTGAGGGTGGAAGG - Intergenic
904478225 1:30777930-30777952 GAGGGCTCTCTCAGTGTGGAGGG - Intergenic
904559758 1:31388585-31388607 GGGTGTGCCCTCAGTGGTGATGG - Intergenic
905553279 1:38860369-38860391 AGGTTTGCCCTCAGTGTGGCTGG - Intronic
906931830 1:50177600-50177622 TAGTGTGGCCTAAGTTTGGATGG + Intronic
913126999 1:115800590-115800612 GAGTCTTGCCTCAGTGTTGATGG + Intergenic
913183428 1:116344696-116344718 GAGGAGGCCCTCAGTGAGGAGGG - Intergenic
915079011 1:153338511-153338533 GTGTGTGCACTCAGTGCTGAGGG - Intronic
915104024 1:153521328-153521350 GAGTGTGCCTTCTGTGTGGCAGG - Intergenic
918339001 1:183551919-183551941 CACTTTGGCCTCAGTGTGGAGGG - Intronic
1064285471 10:13987406-13987428 AAGTGGGCCCTCATGGTGGAAGG - Intronic
1065660650 10:28001361-28001383 GGGTGTGCCCTCAGTGATGAAGG - Intergenic
1066479159 10:35778845-35778867 GAGACTCCCCCCAGTGTGGAGGG + Intergenic
1069247021 10:66219256-66219278 GAGTGTGTTTTCAGTGTGGGAGG + Intronic
1070863524 10:79692164-79692186 GAGGGGGCTCTGAGTGTGGATGG + Intergenic
1072185047 10:93029095-93029117 GACTCTTGCCTCAGTGTGGATGG - Intronic
1075847904 10:125560973-125560995 GAGTCTTGCCTCAGTGTGGATGG - Intergenic
1076029770 10:127147499-127147521 GAGAGAGCCCTCTGTATGGAAGG - Intronic
1076347212 10:129787465-129787487 GAGTGAGCTCTAAGTGTGCATGG - Intergenic
1076853203 10:133103082-133103104 GAGGGGGCCCTGAGGGTGGAGGG + Intronic
1076943095 10:133622995-133623017 GAGTGTGACTCCCGTGTGGACGG + Intergenic
1077958841 11:7051239-7051261 GCATGTTCCCCCAGTGTGGATGG + Intronic
1078533639 11:12156296-12156318 ATGTGTGCCTTCAGTGTGCATGG + Intronic
1080560222 11:33456498-33456520 GAGGATCACCTCAGTGTGGAAGG - Intergenic
1080812754 11:35721955-35721977 GAGTCTGGCCTAAGTTTGGAAGG + Intronic
1082694036 11:56337648-56337670 GTGTGTGCCTGCTGTGTGGAGGG - Intergenic
1082913370 11:58402924-58402946 AAATGTGTCCCCAGTGTGGATGG + Exonic
1084177582 11:67431468-67431490 GAGTTTGCCACCAGTCTGGAAGG - Exonic
1085283206 11:75344241-75344263 GAGTGTGTCCTGGGTGGGGATGG - Intronic
1088510694 11:110570996-110571018 GAGTGTGCCCTGCGTTGGGATGG - Intergenic
1090922063 11:131215394-131215416 GAGTCTACTCTCAGGGTGGATGG - Intergenic
1092012722 12:5128390-5128412 GAGTGTGGCATCACAGTGGAAGG - Intergenic
1096798586 12:54094206-54094228 GATTCTGCCCTCAGTGGAGATGG + Intergenic
1097696719 12:62781758-62781780 TCGGGTGCCCTCTGTGTGGATGG + Intronic
1099005041 12:77225651-77225673 TTGTGTGGCCTCAGTCTGGAAGG + Intergenic
1101887152 12:108675108-108675130 GGGTTTCCCCTCAGTGTTGATGG - Intronic
1103033848 12:117640595-117640617 GCGTGTTCCCACAGTGTGGCAGG + Intronic
1112337899 13:98529469-98529491 GAGTGTGACCTCAGTGTGAAGGG - Intronic
1112627588 13:101123186-101123208 GAATGGGCCCTCTGTGTGAATGG - Intronic
1113815375 13:113166382-113166404 GAGTGTGGCTGCCGTGTGGATGG + Intronic
1113990353 14:16023473-16023495 GAGTGTGACTCCTGTGTGGATGG + Intergenic
1116425430 14:44784739-44784761 GAATGGACCCTCAGTGGGGAGGG - Intergenic
1118104856 14:62647041-62647063 GAGAGTTCCATCAATGTGGAAGG - Intergenic
1120558574 14:85960933-85960955 GAGTAGGCACTTAGTGTGGAAGG + Intergenic
1121108956 14:91299439-91299461 GTGTGTGCCCTCAGCTGGGAAGG + Intronic
1121865583 14:97359597-97359619 GCCTGTGCCTTCAGTGTGGGAGG - Intergenic
1123878802 15:24654419-24654441 GAATTTGCCCACAGTGTGGAGGG + Intergenic
1126341734 15:47648364-47648386 GAGTGTGCCCTGAGATGGGATGG + Intronic
1128646260 15:69380900-69380922 GAGTGTGCCATGAGTGGAGATGG + Intronic
1128646883 15:69384345-69384367 GAGTGGGCCCTCCGTGTTCATGG + Intronic
1128646918 15:69384469-69384491 GAGTGGGCCCTCCGTGTTCATGG + Intronic
1128646927 15:69384500-69384522 GAGTGGGCCCTCCGTGTTCATGG + Intronic
1129404415 15:75305696-75305718 GAGGGAGCCCTCTGTGTTGATGG + Intergenic
1131431389 15:92392133-92392155 GAGTTTCCCATCAGTGTGGCTGG - Intergenic
1131757239 15:95578398-95578420 AAGTGGGCCCTCAGTCTGGCTGG - Intergenic
1132291433 15:100706307-100706329 GGGTGAGCACCCAGTGTGGAAGG - Intergenic
1132896666 16:2232529-2232551 GAGTGAGCCCTTGGTGCGGAAGG - Exonic
1133087729 16:3378135-3378157 GAGTGTACCCTCCTGGTGGAAGG + Intronic
1135724260 16:24842633-24842655 GAGTGTGCTCTCAGAGGTGATGG - Intergenic
1135952575 16:26928903-26928925 CAGAGTGGCCTCAGTGTGTAAGG - Intergenic
1136047780 16:27628807-27628829 GTGTGTCCCCTCCGTGTGGGAGG - Exonic
1136485806 16:30571184-30571206 GGGGGTGCCCTCAGCCTGGAGGG - Intronic
1136909505 16:34134544-34134566 GAGTGTGACTCCTGTGTGGATGG + Intergenic
1137003681 16:35252946-35252968 GAGTGTGGCCTGGATGTGGAAGG + Intergenic
1137017525 16:35392741-35392763 GAGTGTGGCCTGAATGTGGAAGG - Intergenic
1137551455 16:49440345-49440367 GAGTGTGCCATGCGTGTGGGAGG + Intergenic
1138601189 16:58055630-58055652 GAATGTGACCTCAGTAAGGAGGG - Intergenic
1139846447 16:69924833-69924855 GAATGTGCCCTCAGTCTGGGTGG + Intronic
1140351877 16:74270293-74270315 AAGTGTGCTCTCAGTCTGCAGGG - Intergenic
1141199438 16:81885773-81885795 TCCTGAGCCCTCAGTGTGGATGG - Intronic
1141742499 16:85903206-85903228 CACTGTGCCCACAGTGGGGAAGG - Intronic
1142012496 16:87722966-87722988 GCGTGTGCCCACAGTGTGTGGGG + Intronic
1143462069 17:7110194-7110216 GAGTGTGGCTGCAGTGGGGAAGG - Intronic
1144265812 17:13568126-13568148 GAGTGTTGCCTCAGTGTCGATGG - Intronic
1146518849 17:33510696-33510718 GTGTGTGCTCCCAGTGTGAATGG - Intronic
1146923458 17:36728890-36728912 GATGGTGCCCGCAGTGTGGTCGG + Intergenic
1148758943 17:49989530-49989552 GACTGCTCCCTCAGTGGGGAGGG - Intergenic
1150304376 17:64071813-64071835 CAGTGTCCCCCCAGTGTGCAAGG - Intronic
1152025910 17:77809156-77809178 GGGCCTGCCCTGAGTGTGGAGGG - Intergenic
1154409985 18:14134024-14134046 TAGTGTGCACTCAGTGTGTGTGG - Intergenic
1155536643 18:26825501-26825523 GAGGGTCACCCCAGTGTGGATGG - Intergenic
1157324593 18:46659413-46659435 GGTTGTGCCCTCAATGTGGGTGG - Intergenic
1157592319 18:48843192-48843214 GAGGGTGGCCTCAGTGGGGAGGG + Intronic
1159032969 18:63249891-63249913 GAGCAGGCCCCCAGTGTGGAAGG + Intronic
1159354429 18:67319289-67319311 GAGGATAACCTCAGTGTGGAAGG + Intergenic
1160292263 18:77606043-77606065 GAGTGTGCCCGCCGTGTGCCAGG + Intergenic
1160943198 19:1629584-1629606 GGGCGAGCCCCCAGTGTGGAGGG + Intronic
1161482789 19:4519188-4519210 GGGGGTGTCCTCAGTGTGGAGGG + Intergenic
1161581063 19:5081398-5081420 GAGTGTCCCCAGAGTGGGGAGGG + Intronic
1162858420 19:13487508-13487530 GAGTGAGCGCTCAGTGAGTACGG + Intronic
1164460412 19:28442937-28442959 GAGTGAGCCCACAGTGTGGAGGG + Intergenic
1165093759 19:33399782-33399804 AAGTGCGCCCTCAGTGTTCAAGG - Intronic
925106283 2:1295309-1295331 GAGAGTTCCCTCAGAGTGAACGG - Intronic
925409943 2:3634171-3634193 GACTGGGCACTCAGTGTGGGTGG + Intronic
926486697 2:13470497-13470519 GTGTGTAGCCTCAGTGTGAAGGG + Intergenic
926689278 2:15721905-15721927 GAATGAGCCCTCCCTGTGGAAGG + Intronic
928405866 2:31014422-31014444 GAGTTTGCTCTCTGTGTGGTTGG - Intronic
929234048 2:39588191-39588213 GAGTTGGCCCTCAGTGAGAATGG + Intergenic
930049797 2:47206083-47206105 GAGGGAGTGCTCAGTGTGGATGG + Intergenic
930541425 2:52711642-52711664 GATTCTGTCCTCAGTGTGCAGGG + Intergenic
931591503 2:63888600-63888622 GAGTGTGCCCTGAGATGGGATGG - Intronic
933048113 2:77564783-77564805 GAGTGTGCCCTGAGATGGGATGG - Intronic
933328263 2:80865475-80865497 GGGTCTGACCTCAGTGTTGATGG + Intergenic
933940298 2:87239592-87239614 GAGTGTGTCAGCAGAGTGGAGGG + Intergenic
934574174 2:95390050-95390072 AACTGTGCCCTGTGTGTGGAAGG - Intergenic
934851749 2:97706337-97706359 GAGTGTGTCCTGAGAGGGGATGG + Intergenic
935648234 2:105359761-105359783 CAGTGTGCCCTCAGTTGCGAGGG + Intronic
936019211 2:108982003-108982025 GACTGTGCCCTCTTTGAGGACGG - Intronic
936352840 2:111726184-111726206 GAGTGTGTCAGCAGAGTGGAGGG - Intergenic
939357697 2:141125588-141125610 GTGTGTGCCTTCACTGTGCAAGG - Intronic
943985601 2:194614064-194614086 GGGTGTTGCCTCAGTGTTGATGG + Intergenic
946171951 2:217900785-217900807 GAGTGTGCCCTCAGTGTGGATGG - Intronic
946187678 2:217990380-217990402 GTGTGTGGCCTATGTGTGGATGG - Intronic
946242131 2:218362865-218362887 GAGTTTGCCCTCGGTGTCCAAGG - Exonic
947781998 2:232775882-232775904 GTGTTTGCCCTAATTGTGGAGGG - Intronic
948123179 2:235545926-235545948 GAGGGTCCCCTCTGTCTGGATGG + Intronic
948404812 2:237709372-237709394 GGGGGTGGGCTCAGTGTGGATGG - Intronic
948460645 2:238128510-238128532 GAGTGAGGCCTCAGAGGGGAGGG - Intronic
948587095 2:239026339-239026361 GAGTGTGCACTCTGAGTGGTGGG - Intergenic
949053787 2:241912996-241913018 GTGTGGGCCCTGAGTCTGGAAGG + Intergenic
1169756377 20:9047346-9047368 GAGTCTTGCCTCAATGTGGATGG + Intergenic
1170079528 20:12457081-12457103 GTTTCTGCCCTCAGTGTGAAGGG + Intergenic
1171407101 20:24918813-24918835 GAGTGTGCACAAAGTGTGCAGGG - Intergenic
1171771526 20:29326201-29326223 GAGTGTGACTCCTGTGTGGATGG - Intergenic
1171784045 20:29447471-29447493 GAGTGTGACTCCTGTGTGGACGG + Intergenic
1171904973 20:30893276-30893298 GAGTGTGACTCCTGTGTGGATGG + Intergenic
1171905766 20:30898902-30898924 GAGTGTGACTCCTGTGTGGACGG + Intergenic
1172413659 20:34745711-34745733 GAGAGTGGCCTAAGTGTGAAGGG + Intronic
1176863080 21:14024386-14024408 TAGTGTGCACTCAGTGTGTGTGG + Intergenic
1179352833 21:40629590-40629612 GCATGCTCCCTCAGTGTGGAAGG + Intronic
1179675258 21:42976346-42976368 CAATCTGGCCTCAGTGTGGATGG + Intronic
1179909817 21:44441816-44441838 GACTGTGCCCTCAGGCTGGGCGG + Exonic
1180173785 21:46077751-46077773 GAGTGAGCCATCCGTGTGGAAGG - Intergenic
1180316919 22:11284053-11284075 GAGTGTGACTCCTGTGTGGATGG - Intergenic
1180338408 22:11599460-11599482 GAGTGTGACTCCTGTGTGGATGG + Intergenic
1180339179 22:11605003-11605025 GAGTGTGACTCCTGTGTGGACGG + Intergenic
1180729132 22:17968322-17968344 GAGTGTCCCCTCAGTAGGGCGGG - Intronic
1183862297 22:40679026-40679048 GAGGGTGCCCTGAGTGTGCATGG + Exonic
952449282 3:33416054-33416076 TGCTGGGCCCTCAGTGTGGAGGG - Intronic
955922494 3:63972425-63972447 GAGTGTGCACTCTGCATGGATGG - Intronic
957085241 3:75671233-75671255 GAGCGTGACTTCTGTGTGGATGG - Intergenic
958950302 3:100409085-100409107 CAGATTGCCCTCAGTGTGGTTGG + Intronic
959302839 3:104624409-104624431 ATGCATGCCCTCAGTGTGGATGG + Intergenic
960991971 3:123317865-123317887 GAGTGTGCCCTTGGTGGGGTAGG - Intronic
961402681 3:126658181-126658203 CTGTGTGCCATCAGTGTTGATGG - Intergenic
962978937 3:140470498-140470520 GTGTGAGCTCTCAGTGTGGTGGG + Intronic
963770490 3:149381630-149381652 GTGTCTGCGCTCAGTGGGGAGGG - Intergenic
968178109 3:196568790-196568812 GCGTCTGCCCTCAGTGAGGCGGG + Exonic
968402410 4:309474-309496 CAGTGTGCACTCAGTGTGTGTGG - Intergenic
972583507 4:40416029-40416051 CACTGTGGCCCCAGTGTGGAAGG + Intergenic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
974679340 4:65140869-65140891 AAATGTGTCCTCAATGTGGATGG - Intergenic
974950939 4:68582444-68582466 GAGTGGCCCTTCAGTGTGCATGG + Intronic
978273040 4:106914287-106914309 GAGTCAGCCCTCAGTATGGTTGG - Intergenic
978335550 4:107664530-107664552 GAGTGTGCCCTCAGTGTTGTGGG - Intronic
978867155 4:113527175-113527197 GAGTCTTGCCTCAGTGTTGATGG - Intronic
985372372 4:189299645-189299667 GAGTGAGCGTTCAGTGTGAAAGG + Intergenic
985446448 4:190023437-190023459 GAGTGTGACTCCCGTGTGGACGG + Intergenic
985907623 5:2853223-2853245 GAGTGGGCCCCCTGGGTGGAAGG + Intergenic
986148117 5:5099266-5099288 GAGTGGGCACTGACTGTGGAAGG + Intergenic
986344548 5:6822718-6822740 GAGGTTTCCCTCAGTGTGGCTGG + Intergenic
988843286 5:35104191-35104213 CAGTGTGCCCTACATGTGGACGG - Intronic
992175092 5:74142229-74142251 GAGTGTGCCCTGAGATAGGATGG - Intergenic
993383905 5:87240940-87240962 GAGTGTGCCCTGTGTTGGGATGG - Intergenic
994628747 5:102254612-102254634 GAGTCTTGCCTCAGTGTTGATGG - Intronic
996613222 5:125409387-125409409 AACTGTGCCCGCAGTGTGAAAGG + Intergenic
999209058 5:149871777-149871799 CACTGTGGCTTCAGTGTGGAAGG + Intronic
999897424 5:156050281-156050303 GAGTCTTGCCTCAGTGTTGATGG - Intronic
999972945 5:156883165-156883187 GAGTCTGCCTTCAGTGAGGGGGG + Intergenic
1004527364 6:16421812-16421834 GAGTGTGTACACAGTGTGCAGGG + Intronic
1006511551 6:34524249-34524271 GAGTGTGCTGTCAGCATGGAGGG - Intronic
1006778273 6:36613782-36613804 GGGTCTTCCCTCAGTGTTGATGG - Intergenic
1006946386 6:37787171-37787193 GAGTCTTCCCTAAGTGAGGAGGG + Intergenic
1007746817 6:44048124-44048146 GAGGAAGGCCTCAGTGTGGAAGG + Intergenic
1009040731 6:58173677-58173699 GAGTCTTCCCTCAATGTTGATGG + Intergenic
1009216587 6:60928212-60928234 GAGTCTTCCCTCAATGTTGATGG + Intergenic
1011670642 6:89680002-89680024 GAGTGTGCTGTCAGTGAGGGTGG - Intronic
1012503746 6:99920577-99920599 CAGTGAGGCCACAGTGTGGAGGG + Exonic
1018442828 6:163828800-163828822 GACTGTGCCCTCACTGTTGGAGG - Intergenic
1018726090 6:166614481-166614503 GGCTGTGGCCTCAGTGTGGGAGG - Intronic
1019732196 7:2634463-2634485 GAGGGAGCCCTCAGTCAGGATGG - Intronic
1020658406 7:10954250-10954272 GAGTGTGGTATCAGGGTGGAGGG - Intergenic
1021171839 7:17406702-17406724 AAATCTGCCTTCAGTGTGGATGG + Intergenic
1023579544 7:41666742-41666764 GAGTGTACCCTGAGATTGGAGGG + Intergenic
1026498553 7:70923708-70923730 AAGTGTGTCCTCGGTGGGGAGGG - Intergenic
1026502015 7:70951178-70951200 GGGCGTGGCCTCAGGGTGGATGG - Intergenic
1032743202 7:134760202-134760224 GATTGTACCCTGAGTGTGGTAGG + Intronic
1033242229 7:139689951-139689973 GCGTGAGCTCTCACTGTGGATGG - Intronic
1033642534 7:143276089-143276111 GGGTCTTGCCTCAGTGTGGATGG + Intergenic
1035202030 7:157273745-157273767 GAGTGGGCACTGCGTGTGGAAGG + Intergenic
1035350644 7:158243645-158243667 GAGCCTGCTCTCTGTGTGGATGG - Intronic
1038205798 8:25463840-25463862 CAGTGTGCCCTGTGAGTGGAAGG - Intronic
1040832991 8:51698076-51698098 GAGTTTTGCCTCAGTGTTGATGG + Intronic
1046613695 8:116452994-116453016 GAGTGCACGCTCAGTGGGGAAGG - Intergenic
1048523819 8:135182693-135182715 GAGTGTGGCCTCCTTGTGGATGG - Intergenic
1048775223 8:137938345-137938367 GAGTGTAGACTCAGTGGGGATGG - Intergenic
1049064517 8:140302267-140302289 GGGTGTGCCCTTGGTCTGGAGGG - Intronic
1049215064 8:141404020-141404042 GAGTGTGCCCCGAGAGGGGATGG - Intronic
1050178235 9:2891949-2891971 ATGTCTGCCCTCAGTGTGGGTGG + Intergenic
1050307186 9:4316661-4316683 GAGTGTGCCCTGAGATGGGACGG + Intronic
1051818165 9:21133939-21133961 GAGTGTGCTCTGGGTGTGGAAGG - Intergenic
1052642604 9:31188578-31188600 GACTGATCCCTCAGTGTGGAGGG - Intergenic
1053788195 9:41667318-41667340 GATTCTGCCCTCAGTGGAGATGG + Intergenic
1054156943 9:61647450-61647472 GATTCTGCCCTCAGTGGAGATGG - Intergenic
1054176473 9:61878657-61878679 GATTCTGCCCTCAGTGGAGATGG + Intergenic
1054254296 9:62798950-62798972 GAGTGTGACTCCTGTGTGGATGG - Intergenic
1054476715 9:65578458-65578480 GATTCTGCCCTCAGTGGAGATGG - Intergenic
1054661065 9:67702151-67702173 GATTCTGCCCTCAGTGGAGATGG - Intergenic
1055341466 9:75288621-75288643 GATTGTGGCCTCATTGTGGGCGG + Intergenic
1056580508 9:87885868-87885890 GAGTGTGCATTCTGTGAGGAAGG - Exonic
1057019470 9:91685436-91685458 AACTCTGCCTTCAGTGTGGAAGG + Intronic
1058254561 9:102744457-102744479 AAGTGGTCTCTCAGTGTGGATGG + Intergenic
1058836276 9:108861023-108861045 GATTCTGCCCTGAGTGTGGCAGG + Intergenic
1062638773 9:137506082-137506104 GAGTGTCCCCTCTGTGTGTAGGG - Exonic
1203365223 Un_KI270442v1:249991-250013 GAGTGTGACTCCTGTGTGGATGG - Intergenic
1203376931 Un_KI270442v1:384072-384094 AAGTGTGACCCCTGTGTGGATGG + Intergenic
1186545428 X:10444303-10444325 GGCTGGGCCCTCAGTGTGTAAGG + Intergenic
1186887117 X:13925031-13925053 GAGTTTTCCCTCAGTGATGATGG + Intronic
1187214422 X:17262702-17262724 GAATGTGCCCTCAGTGATAATGG - Intergenic
1187736619 X:22311404-22311426 TAGTGTGCCCACAGTGAGGGGGG + Intergenic
1189213048 X:39300898-39300920 CAGTGAGCCCTGAGTGTGCAAGG + Intergenic
1189901269 X:45709130-45709152 TAGTATGCCCGCAGTATGGAAGG - Intergenic
1194601174 X:95923631-95923653 GAGAGTGCCCAAAGTGTGTAAGG + Intergenic
1197647484 X:129033741-129033763 GCGATTGCCCTCAGTGTTGAAGG + Intergenic
1197745499 X:129930301-129930323 GAGTGGGCCCTGAGTTAGGAAGG - Intergenic
1201073517 Y:10170435-10170457 GAGTGTGACTCCTGTGTGGATGG + Intergenic