ID: 946173478

View in Genome Browser
Species Human (GRCh38)
Location 2:217908979-217909001
Sequence TGACTTACCCTGAGTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946173478_946173483 11 Left 946173478 2:217908979-217909001 CCTAACCCACTCAGGGTAAGTCA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 946173483 2:217909013-217909035 GCTGCCTGCTTATTAGGACCAGG 0: 1
1: 0
2: 0
3: 6
4: 80
946173478_946173482 5 Left 946173478 2:217908979-217909001 CCTAACCCACTCAGGGTAAGTCA 0: 1
1: 0
2: 0
3: 11
4: 105
Right 946173482 2:217909007-217909029 CGTGGAGCTGCCTGCTTATTAGG 0: 1
1: 0
2: 0
3: 3
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946173478 Original CRISPR TGACTTACCCTGAGTGGGTT AGG (reversed) Intronic
902632108 1:17711076-17711098 TAACTTACCCTGGGAGGGTTGGG - Intergenic
905259961 1:36710131-36710153 TGCCCTGCCCTGAGTGGGTGGGG + Intergenic
907586597 1:55623427-55623449 TGACTTTCCCTGAGGCAGTTTGG + Intergenic
908185593 1:61649950-61649972 TGTCTAACCCTGAGGGGATTGGG - Intergenic
913229703 1:116731574-116731596 GGAATTACACTGACTGGGTTAGG - Intergenic
913677753 1:121157780-121157802 TGAATCACCCTCAGTGGGATGGG - Intergenic
914029587 1:143945409-143945431 TGAATCACCCTCAGTGGGATGGG - Intronic
914159862 1:145122541-145122563 TGAATCACCCTCAGTGGGATGGG + Intergenic
915018273 1:152757135-152757157 GCATTTACCCTGAGTGGATTTGG + Intronic
915718078 1:157963201-157963223 TGACCTACCCTGGGAGGGTCTGG + Intergenic
916052545 1:161046474-161046496 AGACCTACCCTGAATGGATTTGG + Intergenic
918869721 1:189953754-189953776 TCACTTACTCTCAATGGGTTCGG - Intergenic
920066510 1:203273368-203273390 TGACTTACTCTGGGTGTGTGTGG + Intronic
920465059 1:206176290-206176312 TGAATCACCCTCAGTGGGATGGG - Intergenic
920681575 1:208077157-208077179 TGACCTCCCCCGAGTGGCTTGGG + Intronic
921418884 1:214923169-214923191 TGCCTTTCCCAGAGTGGATTTGG + Intergenic
1067773978 10:49148317-49148339 TGACTGGCCCTGAGTGATTTAGG - Intergenic
1070715540 10:78718373-78718395 TTATTTACCCTCTGTGGGTTAGG + Intergenic
1071847396 10:89535237-89535259 TCACTTGCCCTGTCTGGGTTGGG - Intronic
1078659007 11:13269929-13269951 TGACTTGCCCTGGTTGGGCTGGG - Intergenic
1079283250 11:19106757-19106779 TCCCTTACCCTAAGTGGTTTAGG - Intergenic
1081596870 11:44465545-44465567 TGACTTGCCCTGGGGGGATTTGG + Intergenic
1089010005 11:115124431-115124453 CCACTTAGACTGAGTGGGTTTGG + Intergenic
1097260636 12:57718132-57718154 TGGCTTCCCCTGGGTGGGTAGGG - Exonic
1101934672 12:109047693-109047715 TGACTTACTCAGAGTGTGTTGGG + Intronic
1103639040 12:122333596-122333618 CGGCTTTCCCTGAGTGGGATGGG + Intronic
1104432915 12:128731436-128731458 TAAGTCACCCTGAGTGGGCTAGG - Intergenic
1104757157 12:131276533-131276555 TGACTTTTCCTGAGTGATTTTGG + Intergenic
1107291533 13:38859928-38859950 AGTTTTACCCTGAGTGGGTCAGG + Intronic
1110094364 13:71497735-71497757 GGACTAACCCTGAGTTAGTTTGG + Intronic
1111369331 13:87296234-87296256 TCCCTTACACTGTGTGGGTTAGG - Intergenic
1117344613 14:54819997-54820019 TGACTTTCACTGAGTGAGATGGG - Intergenic
1119788390 14:77329040-77329062 TGAACTTCCCTGAGGGGGTTTGG + Intronic
1121000458 14:90448490-90448512 TGACTTACGCTGGGTTGGTTTGG - Intergenic
1123130810 14:105983924-105983946 TCAGTTACCCTGAGGGGTTTAGG - Intergenic
1123581043 15:21715144-21715166 TCAGTTACCCTGAGGGGTTTAGG - Intergenic
1123617692 15:22157767-22157789 TCAGTTACCCTGAGGGGTTTAGG - Intergenic
1126131757 15:45348556-45348578 AGGCTTCCCCTGAGTGAGTTGGG + Intergenic
1130143786 15:81256055-81256077 TGAATTAGCAAGAGTGGGTTTGG - Intronic
1131567360 15:93498541-93498563 TGACCCACCCTGTGTGGCTTTGG + Intergenic
1133170029 16:3977055-3977077 TGACTTTCCTTGAGTGGGGTAGG - Intronic
1137512494 16:49113968-49113990 TGGCTTACCTGGAGTGGGTCTGG + Intergenic
1138505949 16:57478368-57478390 TGGCTCAGCCTGAGTGGGGTTGG - Intronic
1138743965 16:59341801-59341823 TTCCTTACCCTGAGTGTCTTTGG + Intergenic
1140677377 16:77345816-77345838 TGACTGACACTGAGTTGATTTGG - Intronic
1144367965 17:14562905-14562927 TTACTTGCACTGAGTGGGCTGGG - Intergenic
1147320070 17:39640665-39640687 TCACTGGCCCTGAGTGGGTCAGG + Intronic
1148194741 17:45705305-45705327 TGACTGGCCCTGAGTGGCTGGGG - Intergenic
1155095446 18:22550801-22550823 TCTCTTACCCTGAGTGAGATGGG + Intergenic
1155620791 18:27776943-27776965 GGACTTAACCTGAGTTGTTTGGG - Intergenic
1156752691 18:40478759-40478781 TTACTTACCCAGTGTGGCTTAGG + Intergenic
1157142284 18:45121432-45121454 TGACTTTCTCTGAGTGGGAGAGG - Intergenic
1165208775 19:34215549-34215571 TGATGTACCCTGAGTTGATTTGG + Intronic
1166095254 19:40534403-40534425 TGACATACCTTGAGTGGGGTTGG - Intronic
1167149437 19:47700392-47700414 TGATTTACCCCCAGTGGGTTTGG + Intronic
925005207 2:437963-437985 TGACTGACACTGAATGGGTGGGG + Intergenic
929550064 2:42884543-42884565 GGAATAACCCTGAGTGGGTTTGG - Intergenic
935082504 2:99812071-99812093 TGTCTTACCTTGAGGGGGTGTGG + Intronic
935296690 2:101656148-101656170 GGACTCACACTGAGGGGGTTGGG - Intergenic
946173478 2:217908979-217909001 TGACTTACCCTGAGTGGGTTAGG - Intronic
948667056 2:239542716-239542738 TGACTTCCTTCGAGTGGGTTAGG - Intergenic
1169745596 20:8939354-8939376 TGATTTACCCTGATATGGTTTGG - Intronic
1170143035 20:13143987-13144009 TGACATGCTCTGAGGGGGTTAGG - Intronic
1172791593 20:37509677-37509699 AGACTTACCCTCAGTCTGTTGGG - Intronic
1174548683 20:51345416-51345438 TGCCATTCCCTGAGTGGGTTGGG - Intergenic
1181348211 22:22235982-22236004 CGACTAACCCTGATTGGATTTGG + Intergenic
1184887961 22:47358009-47358031 TGTCTTCACCTGAGTGGGTGAGG - Intergenic
951996987 3:28741791-28741813 TCAATGAACCTGAGTGGGTTGGG + Intergenic
953261001 3:41339084-41339106 TGTCTCAACCTGACTGGGTTGGG - Intronic
956064606 3:65383992-65384014 TGACTTAGCCTGAGTGTTCTTGG - Intronic
960999651 3:123365574-123365596 GGACTTCCCCTAAGTGGATTAGG - Intronic
961359698 3:126359135-126359157 TTACTTACTCTGAGTGAGTTGGG - Intergenic
961715326 3:128853729-128853751 TGACTTCCCCTCTGTGGGCTGGG + Intergenic
962753045 3:138448776-138448798 TGACTGCCCCTGAGTAAGTTTGG - Intronic
965725000 3:171706101-171706123 TGACTGACCCGGTGTTGGTTTGG - Intronic
966529844 3:180964575-180964597 TTACTGAACCTGAGTGGGCTTGG + Intronic
971581656 4:28348959-28348981 TGACTGACCATGAGTGGTTCTGG + Intergenic
971808191 4:31388152-31388174 TGACTTATCATGGGAGGGTTTGG + Intergenic
974608214 4:64181260-64181282 TGACTTGCCCTGTGTGTCTTGGG + Intergenic
978968548 4:114773270-114773292 TGACTTTTCCTGAGGGGGTAAGG - Intergenic
997600410 5:135134874-135134896 TGTCACACCCTGTGTGGGTTGGG - Intronic
997717475 5:136052877-136052899 TGACTTGACCTGAGTCTGTTTGG + Intronic
998965989 5:147540585-147540607 TGAGCTACCTTGAGTGGGGTGGG - Intergenic
999522322 5:152363589-152363611 TGACTTACTCAGACTGGGCTTGG + Intergenic
1001584864 5:172826967-172826989 TGACTTCCCCAGTGTGAGTTAGG - Intergenic
1001591627 5:172869409-172869431 TGACTCACACCGAGTGGGATGGG + Intronic
1002436837 5:179236705-179236727 TGACTGACCCTGAGAGGTTGAGG + Intronic
1003464698 6:6367676-6367698 AGACTTACCCAGAGTGGGTGGGG + Intergenic
1004863851 6:19835069-19835091 TGAGTTACTCTGTGTGGGGTGGG - Intergenic
1018362230 6:163083171-163083193 TGACTTTTCCTGAGTGATTTTGG - Intronic
1021503413 7:21354560-21354582 TGTCATAACCTGAATGGGTTTGG - Intergenic
1021591206 7:22264717-22264739 TGATTTACACAGAGTGGGATTGG - Intronic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1028985256 7:97004191-97004213 TGCCTTAACCTGCGTGGGTCTGG + Intergenic
1032285097 7:130533745-130533767 TGACTGACCCTGAGGTGGTAGGG + Intronic
1033338796 7:140475849-140475871 TGAGTTACCTTGAGTGTGTGAGG - Intronic
1034873589 7:154705558-154705580 TGACACACCCTGGGTGGGTCAGG - Intronic
1035866511 8:3089042-3089064 TGTCTTATCCTAAGTGAGTTAGG - Intronic
1036496843 8:9277494-9277516 TCACTTACCTTTAGTGGGGTTGG + Intergenic
1036596797 8:10220488-10220510 TGATTCACCCTGAGTAGGCTTGG - Intronic
1038079923 8:24122642-24122664 TGCCTTTCCCTGTGTGAGTTTGG - Intergenic
1038805807 8:30790239-30790261 TGACTGCTCCTGAGTGGGTATGG + Intronic
1044925960 8:97209020-97209042 TGAGTAACCCTGAGTGAGGTGGG - Intergenic
1047695435 8:127398930-127398952 TGACTTAGCCTGGGTGAGTCAGG - Intergenic
1048208984 8:132439150-132439172 TGACTTTGCCAGAATGGGTTAGG - Intronic
1055846612 9:80572432-80572454 TGATTTATCCTGAGTGAGTTTGG - Intergenic
1056402266 9:86239922-86239944 TGTCTTACCCTGAGTGGTGCTGG - Intronic
1061260945 9:129480870-129480892 TGACTGACCCTGCCTGGGCTGGG + Intergenic
1186224959 X:7388572-7388594 TGACTTACCCACATTGGCTTAGG + Intergenic
1187633933 X:21205873-21205895 TGGCTTAGCCTCAGTGGGTGTGG + Intergenic
1188037450 X:25334594-25334616 TGACTTAGCTTTATTGGGTTTGG + Intergenic
1190777008 X:53560783-53560805 TGACTTCCACAGATTGGGTTAGG + Intronic
1196034143 X:111124737-111124759 TTATTTCCCCTGAGAGGGTTTGG - Intronic
1197713657 X:129690082-129690104 GGGCTTACCCTGGGTGGATTTGG + Intergenic
1197955005 X:131937026-131937048 TGAATTACCTTGACTGGCTTAGG + Intergenic
1198601147 X:138285577-138285599 TGAGGGACCCTGAGTGGGATGGG - Intergenic
1200072573 X:153536441-153536463 GGACTTACCCTCTGTGGGTGAGG - Exonic