ID: 946174617

View in Genome Browser
Species Human (GRCh38)
Location 2:217914866-217914888
Sequence TCTGCAAAGTAGAACTTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946174617 Original CRISPR TCTGCAAAGTAGAACTTGGT AGG (reversed) Intronic
902086124 1:13864005-13864027 TATGGAAACTAGAAATTGGTGGG + Intergenic
904313762 1:29646562-29646584 TCTGGAAAGCAGACCTTGGCAGG + Intergenic
904874610 1:33644440-33644462 TCTGCCAAGAAGAACTCAGTTGG + Intronic
906803968 1:48761867-48761889 TCTTCCCAGGAGAACTTGGTGGG + Intronic
907301260 1:53487767-53487789 TCTGGAAAGTGGAACTGGGTTGG - Intergenic
908489390 1:64627863-64627885 CATGCAATGAAGAACTTGGTTGG - Intronic
908938770 1:69407982-69408004 TCTGGACATTAGAACTTTGTTGG + Intergenic
909426338 1:75529466-75529488 TCTGTAGAGTAGAACCTGGAAGG - Intronic
910096610 1:83529803-83529825 TCTGGATATTAGAACTTTGTCGG - Intergenic
910494514 1:87811544-87811566 TCTCCCAAGTATAACTTGCTTGG + Intergenic
914217556 1:145646472-145646494 TCTCAAAAGTAGCAATTGGTGGG + Intronic
914470123 1:147969163-147969185 TCTCAAAAGTAGCAATTGGTGGG + Intronic
914790518 1:150873376-150873398 ACTGGCAAGTAGAACTCGGTGGG - Intronic
915475548 1:156150761-156150783 TCTGCACAATAGAACCTGGCAGG + Intronic
920038853 1:203083303-203083325 TCAGCACAGGAGACCTTGGTCGG + Exonic
920608125 1:207410061-207410083 TCTGGATATTAGAACTTTGTTGG - Intergenic
920688685 1:208129379-208129401 GCTACAACATAGAACTTGGTAGG - Intronic
921630109 1:217423140-217423162 TATGCAAGGGAGAGCTTGGTAGG + Intergenic
923123404 1:231014767-231014789 TCAGGAAAGTAGATTTTGGTGGG - Intergenic
1065308757 10:24394290-24394312 TCTGCAAATGAAAAGTTGGTGGG - Intronic
1066097780 10:32088644-32088666 TCTGGAAAATAGAACTTTGTTGG + Intergenic
1066422498 10:35275830-35275852 TCTGCAAACTGGACCTAGGTCGG + Intronic
1067051603 10:43024780-43024802 TCTGCAAACTTGAACATTGTGGG - Intergenic
1068211564 10:53926101-53926123 ACTGCAAAAGAGAAGTTGGTAGG - Intronic
1071126423 10:82340713-82340735 TGTGCAAAGTAGATATTGGGGGG - Intronic
1072888312 10:99299403-99299425 TCTGCAAGGAAAAATTTGGTTGG + Intergenic
1074710787 10:116175849-116175871 CCTGCAAAGTTGAAATGGGTAGG - Intronic
1077526021 11:3065559-3065581 TCTGGATATTAGACCTTGGTCGG + Intergenic
1078151267 11:8761421-8761443 TCTGGCAAGGAGAACATGGTGGG + Intronic
1078563164 11:12390612-12390634 CCTGCAAAGTAGAGGTCGGTGGG + Intronic
1078783767 11:14466309-14466331 TCTGCAAAGTATCACTGGTTTGG + Exonic
1080940495 11:36912607-36912629 TCTGGAAAGTAGGACTGGGGAGG + Intergenic
1084437311 11:69151431-69151453 TCTGGATATTAGACCTTGGTCGG - Intergenic
1085222527 11:74887322-74887344 TCTGGATAGTAGACCTTTGTTGG - Intronic
1085831201 11:79902849-79902871 TTGGCAAAGTAGAAGTTGGAGGG - Intergenic
1086642319 11:89174961-89174983 TCTCCAAAGTGGAAGTAGGTTGG - Intergenic
1086759943 11:90616110-90616132 TCTGCCAACTATAATTTGGTTGG + Intergenic
1087250007 11:95888366-95888388 TAGGCAAAGCAGAACTTAGTTGG - Intronic
1087475312 11:98626686-98626708 TAAGAAAAGAAGAACTTGGTGGG - Intergenic
1088872856 11:113907163-113907185 TCTGGAAAGTAGAATGTGTTAGG - Intronic
1094723943 12:33093004-33093026 TCTGAAAAATATAACTTGTTTGG - Intergenic
1095503993 12:42872598-42872620 TATGGAAATTAGAACATGGTCGG - Intergenic
1095914157 12:47459107-47459129 TCTGCAAAATAGATGTTGGAAGG - Intergenic
1096201958 12:49690667-49690689 TTAGCAAAGGAGAACTTGTTCGG + Intronic
1097005162 12:55911445-55911467 TCTGCAAAGCCGACCTTTGTAGG - Intronic
1098761431 12:74430161-74430183 TCTTCTTAGTAAAACTTGGTAGG + Intergenic
1099088180 12:78273221-78273243 TCTGAATATTAGAACTTTGTTGG + Intergenic
1100742682 12:97611776-97611798 TCGGCAAAGTAGAACTAGAGGGG + Intergenic
1101397482 12:104361154-104361176 TCTCCAAAGTTCAACTGGGTAGG + Intergenic
1102066407 12:109979697-109979719 TCTGAAAAGTAAATCCTGGTTGG - Intronic
1106910792 13:34461513-34461535 TCTGCAAAGCAGAACCTGGAAGG - Intergenic
1108076718 13:46687658-46687680 TATTCAAAGTAGAATTTGGAGGG + Intronic
1109484059 13:62996223-62996245 TCTGAAAAGTTGAACCTGGAGGG + Intergenic
1109582363 13:64358441-64358463 ACTCCAAAGAAGAAGTTGGTGGG - Intergenic
1109589125 13:64453851-64453873 ACAGCAATGTAGAACATGGTAGG + Intergenic
1109878770 13:68443084-68443106 GGTTCAAAGTATAACTTGGTAGG + Intergenic
1111387894 13:87552589-87552611 TCTGCATATTAGTACTTTGTAGG - Intergenic
1111950889 13:94708162-94708184 TCTGCACAGTCTAACTTGGCAGG + Intergenic
1114692663 14:24599274-24599296 TCTGGATATTAGAACTTTGTTGG + Intergenic
1116149885 14:41127447-41127469 TATCCTAAGTAGGACTTGGTAGG + Intergenic
1117201187 14:53391694-53391716 TAAGCAAAGTAGAACTTGGAAGG + Intergenic
1117317428 14:54586316-54586338 TCTGCAAATTAGTCCTTTGTTGG + Intronic
1118665977 14:68070169-68070191 TCTGGATATTAGACCTTGGTTGG + Intronic
1122540530 14:102495538-102495560 TCTGCAAAGCAGGGCTGGGTGGG + Intronic
1125230337 15:37447530-37447552 ACTGCAAAGTAGACCTTGTTTGG + Intergenic
1126378062 15:48016378-48016400 TCAGCAAACCAGAACTGGGTGGG + Intergenic
1131220019 15:90575978-90576000 ACTGCAGGGTAGAACTAGGTTGG + Intronic
1133396519 16:5451810-5451832 TATGCAAAGTAAAACTTGAAAGG - Intergenic
1134438505 16:14283242-14283264 TCTGTAAAGTAGAAATTCTTAGG - Intergenic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1136590011 16:31212823-31212845 TCTGGATAGTAGATCTTTGTTGG + Intergenic
1137059162 16:35770575-35770597 TCTTCAAAGTATAACTTTGTAGG + Intergenic
1137999752 16:53264093-53264115 TCTGTAAAGTGAAATTTGGTTGG + Intronic
1138421962 16:56904742-56904764 TTTGCCAAGTGGAATTTGGTAGG - Intronic
1144213433 17:13034294-13034316 TCTGCAAAGTAGGAGAGGGTGGG + Intergenic
1147056541 17:37839360-37839382 GCAGCAAAGCAGAACTGGGTGGG + Intergenic
1150279011 17:63918152-63918174 TCTCCAGCGTAGACCTTGGTGGG - Intronic
1153378319 18:4406899-4406921 TCTGCAATGTTGACTTTGGTTGG + Intronic
1155388963 18:25312883-25312905 ACTGCATGGAAGAACTTGGTGGG + Intronic
1156570728 18:38249964-38249986 ACAGCACAGGAGAACTTGGTAGG - Intergenic
1156807193 18:41198938-41198960 TCTGCATAGTAGAAGCTGCTGGG - Intergenic
1156887043 18:42147309-42147331 TCTGGAAATTAGACCTTTGTTGG - Intergenic
1159403709 18:67972536-67972558 TCTGCATATTAGAACTTAGTTGG + Intergenic
1159806674 18:72965296-72965318 TCTTTAAATTAGCACTTGGTAGG + Intergenic
1160268854 18:77365669-77365691 TCTGCAAAGTAGAATGTGTGAGG - Intergenic
1160749120 19:725732-725754 GCTGCAGAGTAGGTCTTGGTGGG + Intronic
1163205023 19:15796066-15796088 TCTTCAGAATAGAACTTGGCCGG - Intergenic
1164925799 19:32129104-32129126 CCTGGAAGGCAGAACTTGGTGGG - Intergenic
927935914 2:27076481-27076503 TTTGCAATGTAGAATTTGGAAGG + Intergenic
929242963 2:39671295-39671317 TGTGTCAGGTAGAACTTGGTGGG - Intronic
931268437 2:60681030-60681052 TCTCCAAAATATATCTTGGTTGG - Intergenic
932042720 2:68318355-68318377 TCTGCAGACTAGACTTTGGTAGG + Intronic
933337119 2:80973065-80973087 TCTGGATATTAGAACTTTGTTGG - Intergenic
933879227 2:86652108-86652130 TCAGCAAAGGAGAAATTGATGGG + Intronic
934664492 2:96160147-96160169 TCTGGATATTAGAACTTTGTTGG - Intergenic
934706976 2:96488406-96488428 CCAACAAAATAGAACTTGGTTGG - Intergenic
937039705 2:118811364-118811386 TCTGGGAAGGAGAACTGGGTGGG - Intergenic
938500455 2:131829322-131829344 TCTGTATAGAAGAACTGGGTGGG + Intergenic
939186783 2:138870407-138870429 TCTGGATATTAGACCTTGGTTGG + Intergenic
940051125 2:149466133-149466155 TTTCCCAAGTAGAACTAGGTGGG - Intronic
941011377 2:160303682-160303704 TCTGCTAAGAAGGGCTTGGTGGG - Intronic
941375085 2:164718570-164718592 TCTGGGCAGGAGAACTTGGTGGG + Intronic
942113075 2:172701182-172701204 TCTGGGAAGCAGAATTTGGTGGG - Intergenic
942264757 2:174211657-174211679 TCTGAAAAATAGAACTGGGGTGG - Intronic
942755083 2:179331056-179331078 TCTGGATAGTAGACCTTTGTTGG - Intergenic
943456624 2:188116010-188116032 TCTGCATAATAGGACCTGGTTGG + Intergenic
943510666 2:188822817-188822839 TCAGTAAAGTAGAAATAGGTGGG - Intergenic
944219227 2:197285700-197285722 CCTGCAAAATAAACCTTGGTTGG + Intronic
946174617 2:217914866-217914888 TCTGCAAAGTAGAACTTGGTAGG - Intronic
947588012 2:231369008-231369030 TCTGGGAAGTAGGACTTGGGAGG - Intronic
1169501079 20:6161281-6161303 TCTCAAAAGGAGAACATGGTAGG + Intergenic
1170636538 20:18110126-18110148 TCTATAAAATAGAACTTGCTGGG + Intergenic
1170909733 20:20553819-20553841 TCTACAAAGAAAAACTTGGCTGG + Intronic
1174702700 20:52625098-52625120 TCTGCAAAGTAATAATAGGTTGG - Intergenic
1177210610 21:18066616-18066638 TCTGGAAAGTATAACTTAGGGGG + Intronic
1177974289 21:27827838-27827860 ACTGCAAAGTAGAACTTTTCTGG - Intergenic
1178618559 21:34154485-34154507 TCTGCAAGGAAGGACTGGGTTGG - Intergenic
1179121798 21:38553932-38553954 TCTGCATATTAGACCTTTGTTGG - Intronic
1181515768 22:23411122-23411144 TCTGGATACTAGCACTTGGTTGG + Intergenic
1184081133 22:42221040-42221062 TCTGCAGAGGAGAGCTTGGAAGG - Intronic
949574951 3:5330168-5330190 TTTGCAAATTAGAAATTGATTGG - Intergenic
951474130 3:23087074-23087096 TCTGCTAAGCAGAACTCTGTGGG + Intergenic
951898309 3:27632551-27632573 ACTGCAAAGCAGAACTTACTGGG + Intergenic
952903733 3:38126398-38126420 TCTGCAAAGTAGAAGTGGGAGGG - Intronic
953649603 3:44790038-44790060 TTTGCAAAGTAGAAATTGTCAGG + Intronic
953822020 3:46214996-46215018 GCTGCCAACTAGAACCTGGTAGG + Intronic
953983486 3:47424610-47424632 CCTGCAAGGTATAACTTGGCTGG - Intronic
959316444 3:104813876-104813898 TCTGGATATTAGAACTTTGTTGG - Intergenic
959787326 3:110316387-110316409 ACTGCATAGAAGAACTTGGAGGG - Intergenic
960214861 3:115019810-115019832 ACTGCAAAGAAAATCTTGGTTGG + Intronic
961178219 3:124853640-124853662 TCTTCCAAGTAGAACCTGGAAGG + Intronic
962101194 3:132344469-132344491 TCAGCAAACTAGACCTTGATGGG + Intronic
964364653 3:155936757-155936779 TTTGTAAAGTAGAAATTGGCAGG - Intronic
966362098 3:179141118-179141140 TCTGAATATTAGAACTTTGTTGG - Intergenic
967263961 3:187673541-187673563 TTTGCAAAATAAAACTTGGCAGG + Intergenic
968435170 4:581686-581708 CCTGCAAAGGAGAACTTGGGGGG - Intergenic
972126016 4:35766511-35766533 TCTGGAAATTAGACCTTTGTTGG + Intergenic
972522802 4:39877113-39877135 TCTGCAGAGTGGAACGAGGTAGG + Exonic
972708069 4:41565113-41565135 TCCTCAAATTAGACCTTGGTAGG + Intronic
974688206 4:65259946-65259968 TCTGCAAAGTAGATCTTGTAAGG + Intergenic
977281437 4:95044756-95044778 GCTGCAAATTAGAACGGGGTGGG + Intronic
980095543 4:128486566-128486588 TCTGGATAGTAGACCTTTGTTGG - Intergenic
980578786 4:134721143-134721165 TCTGGATATTAGAACTTTGTTGG - Intergenic
983736990 4:171073927-171073949 TTTGCAAAGTAGAATTTGCTTGG + Intergenic
988022214 5:25635568-25635590 TCTGCATATTAGACCTTTGTTGG + Intergenic
988119657 5:26944354-26944376 TCTAAAAAGGATAACTTGGTTGG + Intronic
990040538 5:51373864-51373886 TCTTCAAAGTACAAGCTGGTTGG - Intergenic
991638903 5:68733944-68733966 CCTGAACAGTAGAACTAGGTAGG + Intergenic
994629400 5:102265207-102265229 TCTGGAAATTAGACCTTTGTTGG + Intronic
997813123 5:136991299-136991321 TCTCCAAAGTGGTTCTTGGTGGG - Intronic
1002553163 5:180012721-180012743 TCTGCAAATGGGAACTTGGAGGG - Intronic
1002832175 6:832423-832445 TCTGGATATTAGAACTTTGTTGG - Intergenic
1006419522 6:33924562-33924584 TCTGCATAGTAGGTCTTCGTCGG - Intergenic
1007703157 6:43775953-43775975 TCTGGAAAGCAGACCTTGGAGGG + Intronic
1009033232 6:58085672-58085694 TCTGGATATTAGAACTTTGTTGG - Intergenic
1009208841 6:60837447-60837469 TCTGGATATTAGAACTTTGTTGG - Intergenic
1010948845 6:82010743-82010765 TCTGGAAATTAGACCTTTGTCGG + Intergenic
1012246800 6:96935442-96935464 TCGGCAAATTAGATTTTGGTTGG + Intronic
1012253257 6:97003383-97003405 TCTGGATAGTAGACCTTTGTTGG + Intronic
1014618599 6:123636811-123636833 TCTGCAAAGTGCAACTTGACGGG - Exonic
1015260377 6:131230480-131230502 TCTGGAAATTAGACCTTTGTTGG + Intronic
1015963384 6:138673267-138673289 TTTGCAAAGCAATACTTGGTGGG + Intronic
1020551391 7:9610104-9610126 TCTGCCAAGTAGAAATGAGTGGG + Intergenic
1021387636 7:20051307-20051329 TCTGCACAATAAAACTTGGTCGG + Intergenic
1021781515 7:24111393-24111415 TCTGGTAAGCAGTACTTGGTCGG + Intergenic
1023549525 7:41354513-41354535 GCAGCAAAGTAGACCTTTGTAGG - Intergenic
1024414155 7:49082687-49082709 TGTGGAAAGTAGAACTTGCAAGG - Intergenic
1024881657 7:54092654-54092676 TCTGTAATTTAGAACTGGGTTGG + Intergenic
1027873580 7:83741657-83741679 TGTGCAAAGTAGAAATTGAATGG + Intergenic
1028356265 7:89913913-89913935 CCTGCAAAGTTGAACATGGCTGG - Intergenic
1028599446 7:92586086-92586108 TCTGAAAAGTAGGAATAGGTTGG - Intronic
1030596018 7:111539657-111539679 TCTTCAAAGAAAATCTTGGTTGG - Intronic
1031834372 7:126664866-126664888 TCTGGATATTAGAACTTTGTTGG - Intronic
1032672267 7:134096060-134096082 TCTGAAAATTAGACCTTTGTTGG - Intergenic
1033709253 7:143923559-143923581 TCTAGAAAGTAGTACTTTGTTGG - Intergenic
1039119737 8:34132182-34132204 TCTGGATATTAGAACTTTGTTGG + Intergenic
1039168851 8:34717751-34717773 TCTGGACAGTAGACCTTTGTTGG + Intergenic
1039615772 8:38953927-38953949 TATGCAAAGTGGCACTTGGAAGG - Intronic
1041575444 8:59389588-59389610 TTTGCAAAGAAAAACTTGGCAGG + Intergenic
1041852845 8:62412546-62412568 TCTGGATAGTAGACCTTTGTTGG - Intronic
1043199145 8:77340671-77340693 TCTGGATATTAGAACTTTGTCGG + Intergenic
1050591184 9:7161766-7161788 TCTCCAAAGTAGAAGCTGGTGGG - Intergenic
1050760166 9:9059003-9059025 TCTGCCCAGTAGAACAGGGTAGG + Intronic
1053259423 9:36649184-36649206 TTTTAAAAGTAGAACCTGGTGGG + Intronic
1058349465 9:104004473-104004495 TTTAGAAAGTAGAAATTGGTGGG - Intergenic
1058545592 9:106058292-106058314 TCTGGGAAGTAGAAATGGGTAGG - Intergenic
1059110562 9:111555199-111555221 TTTGCCAAATAGAACTTGATAGG - Intronic
1059441655 9:114310831-114310853 TCTGCCCAGTAGAAGTGGGTGGG + Exonic
1059614104 9:115930335-115930357 TCTTCAAAGTAAAACTGGGCTGG - Intergenic
1059667849 9:116466018-116466040 TTTGCAAAGTATAAATTGATAGG - Intronic
1061079179 9:128360105-128360127 TCTGCAAAGTAGGGGTGGGTGGG + Intronic
1062499243 9:136845246-136845268 TCTGTATAGAAGAACTGGGTGGG - Exonic
1062664273 9:137659223-137659245 TCTCCAATGTGGTACTTGGTTGG + Intronic
1187210311 X:17223858-17223880 TATGCAAAGCAGAACATTGTAGG + Intergenic
1187777397 X:22777445-22777467 TCTGCTAATTAGAAGTAGGTGGG - Intergenic
1191646321 X:63485360-63485382 TCTGCATATTAGACCTTTGTTGG - Intergenic
1191673892 X:63774918-63774940 TCTGGATATTAGAACTTTGTTGG - Intronic
1191923807 X:66287080-66287102 TTTGAAAAGTAAAGCTTGGTGGG + Intergenic
1193028036 X:76866625-76866647 TAAGAAAAGTAGAACTTGTTAGG + Intergenic
1193432538 X:81426794-81426816 TCTGAAATGTAGAACCTGCTTGG + Intergenic
1195712806 X:107788110-107788132 CCTAAAAAGTAGAGCTTGGTTGG - Intronic
1198087350 X:133293689-133293711 TATGTAAAGAAGAACTAGGTAGG - Intergenic
1201324047 Y:12734337-12734359 TCTGCAAACTGTACCTTGGTAGG + Intronic