ID: 946175510

View in Genome Browser
Species Human (GRCh38)
Location 2:217919831-217919853
Sequence GTCCCGGGTCAGGCACCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946175510_946175523 28 Left 946175510 2:217919831-217919853 CCCCAGGGTGCCTGACCCGGGAC 0: 1
1: 0
2: 2
3: 13
4: 183
Right 946175523 2:217919882-217919904 GCCCCTGGTCCTCTGAGTCCCGG 0: 1
1: 0
2: 1
3: 26
4: 310
946175510_946175520 3 Left 946175510 2:217919831-217919853 CCCCAGGGTGCCTGACCCGGGAC 0: 1
1: 0
2: 2
3: 13
4: 183
Right 946175520 2:217919857-217919879 GCAGGCAGAAGGAGATGCCGTGG 0: 1
1: 0
2: 2
3: 36
4: 361
946175510_946175521 13 Left 946175510 2:217919831-217919853 CCCCAGGGTGCCTGACCCGGGAC 0: 1
1: 0
2: 2
3: 13
4: 183
Right 946175521 2:217919867-217919889 GGAGATGCCGTGGCAGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 254
946175510_946175525 29 Left 946175510 2:217919831-217919853 CCCCAGGGTGCCTGACCCGGGAC 0: 1
1: 0
2: 2
3: 13
4: 183
Right 946175525 2:217919883-217919905 CCCCTGGTCCTCTGAGTCCCGGG 0: 1
1: 0
2: 5
3: 46
4: 333
946175510_946175517 -8 Left 946175510 2:217919831-217919853 CCCCAGGGTGCCTGACCCGGGAC 0: 1
1: 0
2: 2
3: 13
4: 183
Right 946175517 2:217919846-217919868 CCCGGGACCAGGCAGGCAGAAGG 0: 1
1: 0
2: 1
3: 41
4: 382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946175510 Original CRISPR GTCCCGGGTCAGGCACCCTG GGG (reversed) Intronic
900163067 1:1233473-1233495 GGCCCGGCTCAGGCTCGCTGAGG - Exonic
900973869 1:6005843-6005865 GTCCCAGGGCTGGCACCCTGGGG + Intronic
903280287 1:22246181-22246203 GGCGGGGGTCAGCCACCCTGCGG - Intergenic
904384726 1:30133771-30133793 GGCAGGGGGCAGGCACCCTGGGG + Intergenic
904751118 1:32741912-32741934 GCGGCGGGTCAGGCCCCCTGCGG - Exonic
904916443 1:33973743-33973765 GTCCCTGCTCAGGCACCCTGGGG - Intronic
904961924 1:34340173-34340195 GTCCTGGCTCAGGCACACTTTGG - Intergenic
905172276 1:36116290-36116312 ATCCAGGGCCAGGCACCCCGTGG - Intronic
905476064 1:38229053-38229075 CTCCTGGGTGTGGCACCCTGTGG + Intergenic
905734637 1:40316864-40316886 GGCCCGGGACAGGCAGCGTGGGG - Intronic
906103761 1:43279523-43279545 GCCCCAGCTCGGGCACCCTGTGG + Intergenic
906566825 1:46806854-46806876 GTCCCAGCTCAGGCATTCTGAGG + Intronic
912367810 1:109149471-109149493 GTCCCCGGTCATGCAGCATGGGG + Intronic
913069009 1:115283399-115283421 CCCCAGAGTCAGGCACCCTGCGG + Intergenic
915473915 1:156141351-156141373 TTCCTGGGTCGGGCACCTTGGGG + Intergenic
917789991 1:178493331-178493353 GTCCCGGGGCAGGCACCACGTGG + Intergenic
917975144 1:180233460-180233482 GCCCCGGGTCAGGCGCTGTGAGG - Intronic
918113559 1:181478853-181478875 GCCCCAGATCAGGCAGCCTGTGG - Intronic
921341450 1:214138424-214138446 CTCCCTGGTCAGGCTCCCTGGGG - Intergenic
922763113 1:228144598-228144620 GCCCAGGGCCAGGCCCCCTGGGG + Intronic
922765259 1:228153058-228153080 ATCCCGGGCCTGGCTCCCTGGGG + Intronic
1062787876 10:280340-280362 GTCTCAGGTCAGAAACCCTGAGG - Intronic
1063176870 10:3558873-3558895 CTCCCGGGTCAGTCCCCATGCGG - Intergenic
1064326383 10:14355172-14355194 GTCCCAGTTCAGGGTCCCTGAGG - Intronic
1067025036 10:42837099-42837121 GTCCCGGGTCCTGCACGCCGTGG - Intergenic
1067513141 10:46911764-46911786 GGACCGGGACAGGAACCCTGTGG + Intronic
1067649112 10:48140078-48140100 GGACCGGGACAGGAACCCTGTGG - Intergenic
1069880267 10:71588263-71588285 GCCACGGGCAAGGCACCCTGGGG + Intronic
1070152753 10:73815077-73815099 GACCCGGGTCTGGCACCGTCGGG - Exonic
1072211293 10:93249088-93249110 CGCCCTGGTCTGGCACCCTGGGG + Intergenic
1074832112 10:117256319-117256341 GTCCCTGGTTAGGCAGCCCGGGG - Intronic
1075238745 10:120758084-120758106 GTCCAGGGCCAGGCACCCAGGGG - Intergenic
1075891280 10:125953405-125953427 CTCCCTGATCAGTCACCCTGAGG - Intronic
1077297541 11:1833134-1833156 GTCCCGCTCCAGGGACCCTGCGG + Intronic
1077477994 11:2800013-2800035 GTGCCGGCTCAGCCACCCTCAGG + Intronic
1077900160 11:6481252-6481274 GGCCCGGGCCTGGCGCCCTGAGG - Exonic
1082810712 11:57477290-57477312 GTCCTGGGTGGGGCTCCCTGGGG - Exonic
1083796626 11:65020510-65020532 GCCCCGGGACAGGCTCGCTGAGG + Intronic
1084318295 11:68358564-68358586 ATCCCAGCTCAGGCATCCTGAGG + Intronic
1084318976 11:68362904-68362926 GCCCCGTGACAGGCTCCCTGAGG - Intronic
1084670705 11:70605030-70605052 GGCCTTGGTCAGGCAGCCTGGGG + Intronic
1084713230 11:70857197-70857219 GTCCAGTGTCAGTCATCCTGTGG - Intronic
1086549833 11:88042806-88042828 GCCCTGGGTCAGGCATTCTGAGG - Intergenic
1091282158 11:134387909-134387931 GGCAGGGGTCAGGAACCCTGGGG + Exonic
1091458141 12:623393-623415 CTGCCGGGGCAGGAACCCTGGGG - Intronic
1096191526 12:49623341-49623363 GTCCCGGGTCCGCCCCCCGGGGG - Intronic
1096979778 12:55721737-55721759 GTCCCGGGTCAGCCATGGTGTGG - Exonic
1097193768 12:57232837-57232859 GGGCCAGGTCAGGCTCCCTGAGG + Exonic
1100472025 12:94902166-94902188 GTCTCTGGCCAGGCACACTGAGG + Intronic
1104064723 12:125297252-125297274 GTCCCGAGGCAGGCACACGGTGG + Intronic
1107596329 13:41966617-41966639 GTGCCGGGTCAAGCACTATGAGG - Intergenic
1111975933 13:94967709-94967731 GACCCGGAGCAGGCACCCGGCGG + Intergenic
1113454286 13:110437143-110437165 GTCCTGGGTCCTGCATCCTGGGG + Intronic
1113579225 13:111417058-111417080 CTCCTGGGTCAGGATCCCTGAGG + Intergenic
1122503925 14:102219629-102219651 GTCCCTGGTCAAGCACCCTGGGG + Intronic
1122814883 14:104307469-104307491 GGCACTGGGCAGGCACCCTGGGG - Intergenic
1202904253 14_GL000194v1_random:59478-59500 GTCCCAGGCCAGGCCCCCTCAGG + Intergenic
1123425661 15:20168561-20168583 GTCCGGGGTCCTGCACGCTGTGG - Intergenic
1123534888 15:21175088-21175110 GTCCGGGGTCCTGCACGCTGTGG - Intergenic
1123716703 15:23039183-23039205 GTCCCGGGTAACACGCCCTGTGG + Intronic
1124377172 15:29135706-29135728 GTCACGTGTCAGGCACCATGAGG + Intronic
1124395221 15:29294886-29294908 GTCCCGAGGCTGGGACCCTGTGG + Intronic
1125903598 15:43370847-43370869 GACCCGGCTAAGGCGCCCTGAGG + Intronic
1125972312 15:43921808-43921830 GGCCCGAGTCAGGCATCCTGGGG + Intronic
1131443693 15:92477827-92477849 GTCAGGGGTCAGCCACTCTGGGG - Intronic
1132591197 16:727169-727191 GTCCCGGGTCAGGGGTCTTGCGG + Intronic
1132940333 16:2503130-2503152 GGCCCGGGTGGGGCCCCCTGGGG - Exonic
1133729689 16:8569022-8569044 CTCCTGGCTCAGACACCCTGGGG + Intergenic
1135527256 16:23223408-23223430 TTCCCAGGGCAGCCACCCTGGGG - Intergenic
1136608903 16:31354585-31354607 AACCCGGGTGAGGCACCCTGTGG + Intergenic
1138023066 16:53502591-53502613 GGCCCGGGCCAGGCTCGCTGGGG + Intronic
1138434370 16:56989072-56989094 TTCCCGGGTCAGCCAGCCAGGGG + Intergenic
1138456032 16:57121254-57121276 GTCTTGGGTCAGGCAGCCTGGGG + Intronic
1139972201 16:70783216-70783238 GTGCTGGGTCAGCCACCCAGAGG + Intronic
1141695192 16:85615819-85615841 GACCCGGGTCAGGAACCCAGAGG - Intronic
1141765182 16:86053384-86053406 TTTCCGGGTCATGGACCCTGTGG + Intergenic
1142012138 16:87720942-87720964 GTCCCGGTTCAGACACGCAGAGG - Intronic
1142043163 16:87908457-87908479 GTCCCAGCTCAAGCACCCTAGGG + Intronic
1203016254 16_KI270728v1_random:355443-355465 GGCCCGGGAAAGGCACACTGTGG - Intergenic
1203034589 16_KI270728v1_random:628601-628623 GGCCCGGGAAAGGCACACTGTGG - Intergenic
1142874259 17:2841938-2841960 GACCTGGGTCAGGCAGGCTGTGG + Intronic
1143525398 17:7468982-7469004 GTCGTAGGTCAGGCATCCTGCGG + Intronic
1144304235 17:13952743-13952765 GGCCCAGGCCAGCCACCCTGTGG - Intergenic
1144514979 17:15911099-15911121 GCCCCAGGGCAGGCAGCCTGTGG + Intergenic
1146763882 17:35501396-35501418 GTGCCGGTACAGGCACGCTGTGG - Intronic
1146906883 17:36623692-36623714 GCCCCTGCTCAGGCATCCTGGGG + Intergenic
1148829239 17:50419659-50419681 GTGCCGGTACAGGCACACTGTGG + Intergenic
1152678083 17:81651724-81651746 GTCCTGGCTCAGTCAGCCTGAGG + Intronic
1156232906 18:35172253-35172275 GTCCTGTGCAAGGCACCCTGGGG - Intergenic
1159931438 18:74316186-74316208 GTGCCGGCGCCGGCACCCTGAGG + Intronic
1161115735 19:2495568-2495590 TTCCCGGGTCAGGAGCCCTTTGG + Intergenic
1161218913 19:3108962-3108984 GTCTCGGGTCAGGGGCTCTGGGG - Intronic
1161370714 19:3909422-3909444 GTCCAGGGTCAGGACACCTGCGG - Intronic
1161663229 19:5560002-5560024 GTCCTGGGTTAGGCACCAAGGGG + Intergenic
1165100345 19:33435266-33435288 GTCCCAGCTGAGGCTCCCTGTGG - Intronic
1165363310 19:35350067-35350089 GTCCCCAGCCATGCACCCTGGGG + Intergenic
1166673272 19:44724167-44724189 CTCCCTGGCCAGGCATCCTGGGG + Intergenic
1167548623 19:50144230-50144252 GTCCCAGGACAGGCCACCTGAGG + Intergenic
1167645608 19:50703531-50703553 ATCCCGAGGGAGGCACCCTGAGG - Exonic
1168301466 19:55407457-55407479 ATCCCGGGTCAGGGACCCCCAGG + Intronic
934517767 2:94999463-94999485 GTCCAGGGCCAGGCACCCAGCGG - Intergenic
935331438 2:101980376-101980398 ATCCAGGGCCAGGCACCCAGGGG - Intergenic
937789752 2:125945697-125945719 GTCCCTGGCCCTGCACCCTGGGG + Intergenic
938581303 2:132648885-132648907 GCTCCAGGCCAGGCACCCTGAGG + Intronic
940909388 2:159196714-159196736 CTCCCCAGCCAGGCACCCTGAGG + Exonic
946175510 2:217919831-217919853 GTCCCGGGTCAGGCACCCTGGGG - Intronic
947156280 2:227164953-227164975 GTCCCGGGACAGGCAGCGAGCGG + Intronic
948757970 2:240170107-240170129 GTCCAGGGTCAGGAGCCCAGGGG + Intergenic
1169715038 20:8606452-8606474 ATTCCGTGTCAGGCACCTTGTGG - Intronic
1171122667 20:22579803-22579825 GTCGCGGGTCAGGCAGACTTGGG - Intergenic
1172599774 20:36175745-36175767 GTCCCCGGTCAGCCAGCCTCAGG + Intronic
1172714273 20:36951369-36951391 GGCGCGGGCCAGGCGCCCTGAGG - Intronic
1173606185 20:44333421-44333443 GCCCCGGGTCACACATCCTGTGG - Intergenic
1174191624 20:48744631-48744653 GTCCCGGCTCAGGCACCCACTGG - Intronic
1174777562 20:53359257-53359279 GTCTAGGGTCAGGCAGACTGGGG + Intronic
1175416619 20:58805400-58805422 GCCCCTCCTCAGGCACCCTGGGG + Intergenic
1176035576 20:63034910-63034932 GTCACGGGTCAGCCACCCACAGG + Intergenic
1176035584 20:63034946-63034968 GTCACGGGTCAGCCACCCGCAGG + Intergenic
1176035592 20:63034982-63035004 GTCACGGGTCAGCCACCCGCAGG + Intergenic
1176035600 20:63035018-63035040 GTCACGGGTCAGCCACCCGCAGG + Intergenic
1176035631 20:63035162-63035184 GTCACGGGTCAGCCACCCGCAGG + Intergenic
1176189251 20:63800131-63800153 GTCCCGGCCTCGGCACCCTGGGG + Intronic
1176200267 20:63857006-63857028 GTGCCAGGGCAGGAACCCTGGGG + Intergenic
1176623624 21:9074245-9074267 GTCCCAGGCCAGGCCCCCTCAGG + Intergenic
1179109625 21:38435124-38435146 GTCCCGGGCCAGCCTCCTTGTGG - Intronic
1179671121 21:42949378-42949400 GTGCCGGTACAGGCACGCTGTGG + Intergenic
1180119182 21:45735122-45735144 GTCAAGGTTCAGGGACCCTGGGG + Intronic
1180167706 21:46038561-46038583 GTCCCGGGAAAGGCACTCTGTGG - Intergenic
1181276135 22:21688493-21688515 GTCCCGGGGCAGGCCCCAGGCGG + Intronic
1181453174 22:23037584-23037606 GTTCTGGCTCTGGCACCCTGTGG - Intergenic
1182546992 22:31082210-31082232 GGCCCTGGTCTGGCACACTGTGG - Intronic
1183676287 22:39300564-39300586 GTGCGGGGTCAGGAGCCCTGGGG + Intergenic
1183740044 22:39664288-39664310 GCCCCGGGGCTGGCACCCAGAGG - Intronic
1184411993 22:44331215-44331237 GTCCGGGGGCAGGAACCGTGCGG - Intergenic
1184421009 22:44382924-44382946 GACCCTGGTCAGGCAGCCTCGGG + Intergenic
949562904 3:5219334-5219356 GTTCCTGCTCAGCCACCCTGTGG - Exonic
953668723 3:44944928-44944950 GTCCCGGGACAGGTGTCCTGAGG + Intronic
954373417 3:50182174-50182196 CTCCCCGCTCAGGCTCCCTGGGG - Intronic
954696246 3:52428601-52428623 GTCCTGGGCCAGGCATCATGAGG - Intergenic
958868549 3:99529982-99530004 ATCCCTGGTCAGGCACCTTAGGG - Intergenic
959573646 3:107911080-107911102 GTCCCCGGTCTGGCCTCCTGAGG + Intergenic
966257785 3:177938171-177938193 GACCTGGATCAGGCACACTGAGG + Intergenic
969573935 4:8025563-8025585 GGCCCAGGACAGGCCCCCTGGGG - Intronic
983269153 4:165540424-165540446 GTCCCTGGTCAGCTACCGTGAGG - Intergenic
985923409 5:2996952-2996974 GCCCCGGGTCATGCACACTTTGG + Intergenic
986540790 5:8841817-8841839 GTCCCAGGCCCGGCAGCCTGAGG + Intergenic
987930759 5:24397249-24397271 GTGCCGGTACAGGCACACTGTGG + Intergenic
989102653 5:37836342-37836364 GTCCCGGTGCAGGCAACCCGGGG + Intronic
996028488 5:118678729-118678751 TTCCCGTGTGAGGCACCCTTTGG - Intergenic
997437612 5:133886226-133886248 TTCCCTGGCCAGTCACCCTGAGG + Intergenic
999320842 5:150614221-150614243 GTCCAGGGTCAGGCAGCCACTGG + Intronic
1001193820 5:169653895-169653917 GTCCCAGCTCAGGCACCCCAGGG - Intronic
1001276206 5:170353598-170353620 GTCCCGGCCCTGGCATCCTGAGG + Intronic
1002834624 6:855717-855739 GTCCTTGCTCAGGGACCCTGGGG + Intergenic
1007105126 6:39278544-39278566 GTCCCAGGGCTGGCACCCAGTGG + Intergenic
1007487707 6:42193682-42193704 GTCCCGGGACAGGCACTGTGGGG + Intronic
1007746838 6:44048217-44048239 GTCCTGGGGCAGGAACCCAGGGG + Intergenic
1010502210 6:76615087-76615109 GTACCAGGTCAGACACCATGGGG + Intergenic
1013808714 6:114020511-114020533 GTCCCGGTGCAGGCAGGCTGGGG + Intergenic
1015792213 6:136974952-136974974 TTCCCTGGTCATGCACCCAGAGG - Intergenic
1017219761 6:151952257-151952279 CTCTCAGGTTAGGCACCCTGAGG - Intronic
1017719813 6:157236413-157236435 TTCCCGGGTCAGGGCCGCTGTGG - Intergenic
1018784698 6:167098885-167098907 GCCCCATGTCAGGCACCCTTGGG + Intergenic
1018902631 6:168059042-168059064 GTCCCCTGTCAGGGGCCCTGGGG - Intronic
1018903049 6:168060684-168060706 GTCCAGGGTCAGCCAAGCTGGGG + Intronic
1019519773 7:1455370-1455392 GCCCGGGGGCAGGCGCCCTGAGG + Intronic
1019594573 7:1852444-1852466 GTCCAGGCTCAGGATCCCTGAGG + Intronic
1020001546 7:4759113-4759135 CTCCCGAGACAGGCACTCTGGGG - Exonic
1022667683 7:32427552-32427574 GTACCGGGGCCGGCACCATGGGG - Intergenic
1022843835 7:34190612-34190634 GCCCAAGGTCAGGCAGCCTGAGG - Intergenic
1024919742 7:54544834-54544856 GCCCCGGGCCGGACACCCTGAGG - Intronic
1029704673 7:102269989-102270011 GGCCCGGGCCTGGCCCCCTGTGG - Intronic
1035424333 7:158757643-158757665 ATCCCGCGCCAGGCACCCCGCGG + Intronic
1035584399 8:760856-760878 CTCTCGGTGCAGGCACCCTGAGG - Intergenic
1036492985 8:9244921-9244943 ATCCCGGGCCAGTCTCCCTGGGG - Intergenic
1041324287 8:56648612-56648634 GGGCCTTGTCAGGCACCCTGGGG - Intergenic
1049001568 8:139828620-139828642 GCCCAGTGTCAGACACCCTGGGG - Intronic
1049488155 8:142877057-142877079 GTCCAGGGTCAGGCTCCCCCGGG + Exonic
1049493041 8:142915080-142915102 GTCCAGGGTCAGGCTCCCCCGGG + Exonic
1049618646 8:143588039-143588061 GTCCTGGGTCAGGGACGCAGAGG - Intronic
1053018130 9:34675725-34675747 GCCCAGGCCCAGGCACCCTGAGG - Intergenic
1057294410 9:93827000-93827022 CTCCCTGGTCAGGGCCCCTGGGG + Intergenic
1057775161 9:98001945-98001967 GTCCAGAGTCACACACCCTGTGG + Intronic
1061857145 9:133448636-133448658 CTTCCTGGACAGGCACCCTGAGG - Exonic
1062217556 9:135397466-135397488 CTCCCAGGTGAGGCACTCTGAGG - Intergenic
1062289404 9:135787750-135787772 CTCCCGGGACAGGGACACTGTGG - Intronic
1062529073 9:136992100-136992122 GTCCTGGGTCAGGGATCCAGAGG - Intergenic
1203746808 Un_GL000218v1:44673-44695 GTCCCAGGCCAGGCCCCCTCAGG + Intergenic
1203563299 Un_KI270744v1:74807-74829 GTCCCAGGCCAGGCCCCCTCAGG - Intergenic
1186192806 X:7082735-7082757 GTGACGGGCCAGGCACCCTTAGG - Intronic
1187508607 X:19897523-19897545 CTTCCGGGTCAGGAACTCTGGGG + Intergenic
1189415850 X:40812806-40812828 GTCCGGGGTCAGGGAACCTAAGG - Intergenic
1190691010 X:52913240-52913262 GTTCCTGCGCAGGCACCCTGTGG + Intergenic
1190694973 X:52942552-52942574 GTTCCTGCGCAGGCACCCTGTGG - Intronic
1191083436 X:56538197-56538219 GTCCCAGGCCAGGCACCATTGGG + Intergenic
1196807603 X:119602633-119602655 CTACCGAGTCAGACACCCTGGGG + Intronic
1199641687 X:149868472-149868494 GTCCAGGGACAGGCACAGTGTGG + Intergenic
1200121898 X:153795029-153795051 GTCCCGGCTCCCGCTCCCTGCGG + Intronic
1201160135 Y:11159687-11159709 GTCCCAGGCCAGGCCCCCTCAGG + Intergenic