ID: 946175545

View in Genome Browser
Species Human (GRCh38)
Location 2:217919974-217919996
Sequence GTCTCAAGGTTGGAAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946175540_946175545 6 Left 946175540 2:217919945-217919967 CCCTTTTATGGGTTTTTCTAAGG 0: 1
1: 0
2: 2
3: 26
4: 213
Right 946175545 2:217919974-217919996 GTCTCAAGGTTGGAAATAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 139
946175536_946175545 30 Left 946175536 2:217919921-217919943 CCAGGCCTGGAGACACACAAGAT 0: 1
1: 1
2: 2
3: 14
4: 202
Right 946175545 2:217919974-217919996 GTCTCAAGGTTGGAAATAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 139
946175537_946175545 25 Left 946175537 2:217919926-217919948 CCTGGAGACACACAAGATGCCCT 0: 1
1: 0
2: 2
3: 16
4: 182
Right 946175545 2:217919974-217919996 GTCTCAAGGTTGGAAATAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 139
946175542_946175545 5 Left 946175542 2:217919946-217919968 CCTTTTATGGGTTTTTCTAAGGA 0: 1
1: 0
2: 2
3: 17
4: 247
Right 946175545 2:217919974-217919996 GTCTCAAGGTTGGAAATAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946175545 Original CRISPR GTCTCAAGGTTGGAAATAGC AGG Intronic
900732310 1:4270307-4270329 GTCTCAATAATGGAAATAACTGG - Intergenic
904478392 1:30778881-30778903 GTTTCAGGGATGGAAATAACGGG - Intergenic
905743395 1:40391978-40392000 GTATCAAGTTTTGAAATATCAGG + Intronic
907774219 1:57497677-57497699 GTCTCAATGGAGGAAATACCAGG + Intronic
909200401 1:72684896-72684918 GTATGCAGGTTGGAAATTGCAGG + Intergenic
914525006 1:148458480-148458502 GTCCCACGGTTTTAAATAGCAGG - Intergenic
919291955 1:195643853-195643875 GTCTCTAGGTTGCACACAGCAGG + Intergenic
919540393 1:198838172-198838194 GTTTCCAGGTTGGAAATACATGG - Intergenic
1066525237 10:36271791-36271813 GCCTGTAGGTTGCAAATAGCTGG + Intergenic
1073067760 10:100773881-100773903 GGCTCAGGGGTGGAAATAGAAGG - Intronic
1083887346 11:65579263-65579285 GTGTCAAGGTTGGTGATAGGGGG + Intronic
1088589792 11:111393571-111393593 CTCTCAGGGTTGGGAACAGCTGG + Intronic
1090408878 11:126493926-126493948 GACTCAAGGCTGGAATTAGTGGG + Intronic
1091872177 12:3902950-3902972 GTCTGAAGGTTTGAAATTGAAGG - Intergenic
1094417571 12:30233525-30233547 GTGTCAAGGTTTGATAGAGCCGG - Intergenic
1096050125 12:48600194-48600216 GTGTAAGGGTTGGAAATAACAGG - Intergenic
1096239485 12:49951981-49952003 GGCTCAAGGATGGAAAAGGCCGG - Intronic
1096765321 12:53883279-53883301 CTATAAAGGTTAGAAATAGCAGG - Intergenic
1098313142 12:69167440-69167462 CACTCAGGGTTGAAAATAGCTGG + Intergenic
1098359715 12:69642578-69642600 GGCTGAAGGATGGAAATAGCAGG + Intergenic
1098856633 12:75660159-75660181 ATTTCAGGGGTGGAAATAGCAGG - Intergenic
1101276394 12:103206318-103206340 GACTCTAAGTTGGAAATTGCAGG - Intergenic
1101319947 12:103664683-103664705 TTATGAAGGCTGGAAATAGCTGG + Intronic
1101875771 12:108596204-108596226 GACTCAGGGTGGGAAATTGCTGG - Intronic
1102747860 12:115265814-115265836 GTCTCAAAGTGGGAAATTGGGGG - Intergenic
1106782384 13:33072068-33072090 GTCTCCAGGTGAGAAAGAGCAGG - Intergenic
1111995517 13:95162534-95162556 ATCTCAAGGTAAGAAATAGAAGG + Intronic
1112207726 13:97341537-97341559 GTCTGAATGTGGGAAATAGATGG - Intronic
1113133125 13:107060274-107060296 GCCTCAAGGTTGAACACAGCAGG + Intergenic
1113455147 13:110443461-110443483 TTTTCAAGGGTGGAAATAACTGG - Intronic
1117998521 14:61500892-61500914 ATCTCAAAGTTGGAAATACCAGG + Intronic
1119120873 14:72075822-72075844 GTGTCAGTGTTGGAAATGGCAGG + Intronic
1120187127 14:81405416-81405438 GTCTAGAGGTTGGATTTAGCAGG - Intronic
1120921094 14:89756000-89756022 GTCTCAAGGCTGCACAGAGCAGG + Intergenic
1121551677 14:94807523-94807545 GTCTCAAGGCTCGTAGTAGCAGG + Intergenic
1122751799 14:103939906-103939928 GTATCAAAATTGGAACTAGCTGG - Intronic
1123737593 15:23200327-23200349 GTCTCAAGGCTGCACACAGCAGG + Intergenic
1125616400 15:41017709-41017731 TTCTGAAGGTGGGAAATGGCAGG - Intronic
1127164709 15:56232376-56232398 GTCTCTAGGTTGCAAAGAGCAGG + Intronic
1129348965 15:74942967-74942989 ATTTCAAGGTAGGAAATGGCAGG - Intergenic
1129671594 15:77610821-77610843 GCCTCAAGGCTGGTAAGAGCAGG - Intergenic
1130099597 15:80882375-80882397 GTCACAAGGTTGGAAAGTGTTGG + Intronic
1133212903 16:4273024-4273046 GTTTCAAGGCGGGAAACAGCTGG + Exonic
1133620455 16:7521185-7521207 GTCTTAAAGTTGGAAAGATCTGG + Intronic
1135524835 16:23206312-23206334 GTCTCAAGGTTGCAAGAAGGTGG + Intronic
1137987519 16:53122511-53122533 GTAACAAAGTTGGAAATTGCTGG + Intronic
1139338861 16:66254035-66254057 ATCCAAAAGTTGGAAATAGCAGG + Intergenic
1140092956 16:71852266-71852288 GCCCCAAGGTTGGAAATAAGAGG + Exonic
1140437028 16:74955598-74955620 GACTCTATTTTGGAAATAGCTGG + Intronic
1140975994 16:80061024-80061046 GGATCATGGATGGAAATAGCAGG - Intergenic
1148005722 17:44427951-44427973 GTCTCAAAGTGGGAAATAAATGG - Intronic
1148590294 17:48811478-48811500 GCCTCAACCTTGGAAGTAGCTGG + Intronic
1149243649 17:54680114-54680136 GTCTCCAGGTTGGAAAAAATAGG - Intergenic
1151042038 17:70873858-70873880 ATCTCAAGGGTAGAAAAAGCAGG + Intergenic
1152213996 17:79021756-79021778 GCCTCAAGGTAGGACAGAGCCGG + Intergenic
1159606238 18:70478131-70478153 GTCCCAAGGCTGCACATAGCAGG - Intergenic
1160820669 19:1056236-1056258 GTCTCAAGGTGGGAACTGGGGGG + Exonic
1165772760 19:38388430-38388452 GTCTCAAGGTTCTAAAGAGGTGG - Intronic
1166164975 19:40980977-40980999 GTCCCAAGGCTGCACATAGCAGG + Intergenic
926500196 2:13643863-13643885 GTCTCAAGGTTGCACAGAGCAGG - Intergenic
929581909 2:43086757-43086779 GGCTCCAGGTTCCAAATAGCAGG + Intergenic
929782774 2:44967957-44967979 GTCTCCTGATTGTAAATAGCTGG - Intergenic
942389807 2:175480093-175480115 GTCTGTAAGTTGGAGATAGCTGG + Intergenic
942846189 2:180428785-180428807 GTCCCAAGGTTGCACACAGCAGG + Intergenic
943449798 2:188033424-188033446 GTCTCAAGGTTGCAAACAGTAGG - Intergenic
946175545 2:217919974-217919996 GTCTCAAGGTTGGAAATAGCAGG + Intronic
947070206 2:226280513-226280535 GTCTCGAGGGTGCACATAGCAGG - Intergenic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
947644037 2:231724964-231724986 GTCTCAGCTTTGCAAATAGCTGG + Intergenic
948280467 2:236743361-236743383 TTCTCAGTGTTGGAAAGAGCTGG - Intergenic
1170482291 20:16778062-16778084 GTCTCCAGATAGCAAATAGCTGG + Intergenic
1175189293 20:57200284-57200306 GTCACAAGGCCGGAAATAGCAGG + Intronic
1175380757 20:58561438-58561460 GTCTCAAGGTGAGAAGTAGGGGG + Intergenic
1178134314 21:29609778-29609800 GTCTCCAGTTTGCAAATGGCAGG + Intronic
1179179551 21:39034118-39034140 GCCTGTAGGTTGGAAATAGCTGG + Intergenic
1179180772 21:39043029-39043051 GTCTGAAGGCTGGAAAAAACTGG - Intergenic
1182965587 22:34518351-34518373 GGCTCAAGTTTGGAAATTGAGGG + Intergenic
1183109010 22:35634982-35635004 GTCTCCAGCTTGCAAATGGCAGG - Intronic
1184938070 22:47739736-47739758 GTAACAAGGTTGAAAACAGCTGG - Intergenic
958637437 3:96763293-96763315 GTCTCAAGGTTGTACAGAACAGG - Intergenic
960255346 3:115505719-115505741 GTCTCAAGGCTGCACATAGCAGG - Intergenic
961717379 3:128867234-128867256 GTCTCAGAGTTGGAAAGAGGGGG + Intergenic
967444253 3:189547199-189547221 GTCTCAAGGTTTGACATGGAAGG - Intergenic
968052403 3:195664159-195664181 GCCTCAAGTTTGGAAAGGGCAGG + Intergenic
968103409 3:195984181-195984203 GCCTCAAGTTTGGAAAGGGCGGG - Intergenic
968301713 3:197621773-197621795 GCCTCAAGTTTGGAAAGGGCAGG - Intergenic
973685639 4:53366826-53366848 TTCTCCATGTTGGGAATAGCTGG - Intergenic
974832853 4:67210942-67210964 GTCTCTAGGCTGCAAACAGCAGG - Intergenic
977952866 4:102993932-102993954 GTCTCAAGGCTGCATAGAGCAGG + Intronic
979323447 4:119351217-119351239 ATTTCAAGTTTAGAAATAGCGGG + Intergenic
981758510 4:148168012-148168034 CTCTCAAGGTTAGAAGTGGCAGG - Intronic
983006372 4:162490264-162490286 GTCCCAAGGTCGCAAAGAGCAGG - Intergenic
983241275 4:165235895-165235917 ATTTCAAGTTTAGAAATAGCGGG + Intronic
983946930 4:173596785-173596807 GTCTCAAGTTCCCAAATAGCTGG - Intergenic
985079857 4:186253469-186253491 GTCCCAAGATGGGAAATAGTAGG + Intronic
985498611 5:225956-225978 GCCTCAAGTTTGGAAAGGGCGGG + Exonic
987620325 5:20331743-20331765 GTCTCAAGGTGGAATATATCTGG + Intronic
991234455 5:64377735-64377757 GTCCCAAGAGTGGAAATAGACGG - Intergenic
994771563 5:103988381-103988403 GTCTCAACCTTCCAAATAGCTGG + Intergenic
994808222 5:104479216-104479238 GTCTCAAGGCTGTACAGAGCAGG - Intergenic
999393769 5:151213622-151213644 TTCCCAAGGTAGGGAATAGCTGG - Intronic
1005447133 6:25936002-25936024 ATCTCAACTTAGGAAATAGCGGG + Intergenic
1006810580 6:36817904-36817926 GTCTCAAGGGTAGCAATAGGAGG - Intronic
1008207488 6:48680613-48680635 GTCTCATGGTTGGGAATAGTAGG + Intergenic
1010765589 6:79774644-79774666 GAATCAAGGTTGGAAATGGGTGG + Intergenic
1011513693 6:88128824-88128846 GTATCTAGGCTGTAAATAGCAGG + Intergenic
1011525580 6:88260928-88260950 ATCTTATGATTGGAAATAGCTGG - Intergenic
1011876246 6:91965863-91965885 GTCTCAAGGATGCACAAAGCAGG - Intergenic
1013817154 6:114112205-114112227 GAATGAAGGTTGGTAATAGCTGG + Intronic
1014639538 6:123892536-123892558 GTGTCAAGGTTGGGACTAGGTGG - Intronic
1014643572 6:123945259-123945281 GCCTCAACATTGGAAGTAGCTGG - Intronic
1015310759 6:131764698-131764720 ATCTAAAGGTTGGACATAGGGGG + Intergenic
1018086318 6:160303962-160303984 GTCCCAAGGCTGCACATAGCAGG + Intergenic
1024104894 7:46073169-46073191 GACTCAAAATTTGAAATAGCTGG - Intergenic
1028256385 7:88603506-88603528 GTCTCCAGGTTAGGAATTGCAGG - Intergenic
1030283198 7:107798383-107798405 GTCTGCAGGTTGGAAATGGGTGG - Intronic
1030724363 7:112908342-112908364 GTCTGAAGGCAGGAAAAAGCTGG - Intronic
1034415511 7:150962421-150962443 GTCTCAAGGTTGGAATTTCTGGG - Intronic
1034739654 7:153462320-153462342 GTCTCTAGGTTGCACACAGCAGG - Intergenic
1037130776 8:15405668-15405690 TTCTCAGGGTTGGAAACAGAGGG - Intergenic
1041427879 8:57743274-57743296 GTCTCACAGTTGGTAATTGCTGG + Intergenic
1043182379 8:77102349-77102371 TTTTTAAGGTTGGAAATAACAGG - Intergenic
1043244838 8:77984630-77984652 ATCTCAGGGTTGGCAATAGATGG - Intergenic
1044051794 8:87515047-87515069 GTCTCAAGGCTGCACAGAGCAGG - Intronic
1045785724 8:105918444-105918466 GTCTCAAGGCTGCACACAGCAGG - Intergenic
1048257948 8:132919749-132919771 GTCTCTTGGGTGGAAATGGCAGG + Intronic
1048770591 8:137890648-137890670 GAGTCAAGGTTGGACACAGCTGG + Intergenic
1049119693 8:140723711-140723733 GTCTCAAACTTGCAAATAGATGG + Intronic
1050613742 9:7380324-7380346 GTCTTTAGCTTGGAAATTGCTGG + Intergenic
1051346452 9:16155109-16155131 GTCTGAAGTTAGGAAAGAGCAGG - Intergenic
1052657687 9:31383922-31383944 GCCTCAAGGTTGGCTATGGCAGG + Intergenic
1058210488 9:102161695-102161717 GTCCCAAGGTTGCAAACAGCAGG + Intergenic
1059944015 9:119387891-119387913 GTCTCAAGTTGGGAAATTTCTGG - Intergenic
1186148624 X:6650545-6650567 GTCTCAAGGATGGAAGGAGGTGG + Intergenic
1187480661 X:19652167-19652189 GTAACCAGGTTGGAAAGAGCTGG - Intronic
1188719365 X:33504428-33504450 GTGTCAAGGGTGGAAACAGGTGG + Intergenic
1190577362 X:51853981-51854003 GTTTCAGGGTTGGACAGAGCTGG - Intronic
1194339483 X:92691661-92691683 GTCTCAAGGCTGCATAGAGCAGG - Intergenic
1194929391 X:99867774-99867796 GTCTCAAGGCTGCACAGAGCAGG - Intergenic
1195587637 X:106583942-106583964 GTCTCTAATTTGGAAATAACTGG - Intergenic
1196048946 X:111284669-111284691 GTGTAAAGGTTGGAAATCACTGG + Intergenic
1197442868 X:126512101-126512123 GTCTCTAGGCTGCACATAGCAGG + Intergenic
1198558454 X:137821822-137821844 GTCTGAAGGATGGGAAGAGCTGG + Intergenic
1199220357 X:145309733-145309755 GTCTCAAGGCTACATATAGCAGG + Intergenic
1199317737 X:146400478-146400500 GTCCCTAGGTTGCACATAGCGGG - Intergenic
1199776144 X:151013527-151013549 GTCTCAAGGCTGTAAACAGCAGG + Intergenic
1200647868 Y:5808442-5808464 GTCTCAAGGCTGCATAGAGCAGG - Intergenic
1202171558 Y:22050861-22050883 GTCTCAGAGGTGAAAATAGCAGG + Intergenic
1202219804 Y:22535511-22535533 GTCTCAGAGGTGAAAATAGCAGG - Intergenic
1202323373 Y:23660572-23660594 GTCTCAGAGGTGAAAATAGCAGG + Intergenic
1202547398 Y:26009482-26009504 GTCTCAGAGGTGAAAATAGCAGG - Intergenic