ID: 946176137

View in Genome Browser
Species Human (GRCh38)
Location 2:217922857-217922879
Sequence CGCCCACAGCCGTGCATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946176131_946176137 -1 Left 946176131 2:217922835-217922857 CCCGACGGCGTCCTCCATCCTCC 0: 1
1: 0
2: 2
3: 9
4: 195
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176125_946176137 16 Left 946176125 2:217922818-217922840 CCTCGTGGCCTGCCACCCCCGAC 0: 1
1: 0
2: 0
3: 14
4: 221
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176124_946176137 17 Left 946176124 2:217922817-217922839 CCCTCGTGGCCTGCCACCCCCGA 0: 1
1: 0
2: 0
3: 8
4: 97
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176127_946176137 8 Left 946176127 2:217922826-217922848 CCTGCCACCCCCGACGGCGTCCT 0: 1
1: 0
2: 0
3: 19
4: 164
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176132_946176137 -2 Left 946176132 2:217922836-217922858 CCGACGGCGTCCTCCATCCTCCG 0: 1
1: 0
2: 0
3: 6
4: 85
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176122_946176137 19 Left 946176122 2:217922815-217922837 CCCCCTCGTGGCCTGCCACCCCC 0: 1
1: 0
2: 2
3: 44
4: 485
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176130_946176137 0 Left 946176130 2:217922834-217922856 CCCCGACGGCGTCCTCCATCCTC 0: 1
1: 0
2: 2
3: 8
4: 83
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176129_946176137 1 Left 946176129 2:217922833-217922855 CCCCCGACGGCGTCCTCCATCCT 0: 1
1: 0
2: 2
3: 2
4: 77
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176123_946176137 18 Left 946176123 2:217922816-217922838 CCCCTCGTGGCCTGCCACCCCCG 0: 1
1: 0
2: 1
3: 14
4: 206
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176121_946176137 27 Left 946176121 2:217922807-217922829 CCTTGGTGCCCCCTCGTGGCCTG 0: 1
1: 0
2: 3
3: 18
4: 229
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100
946176128_946176137 4 Left 946176128 2:217922830-217922852 CCACCCCCGACGGCGTCCTCCAT 0: 1
1: 0
2: 1
3: 9
4: 87
Right 946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG 0: 1
1: 0
2: 0
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946176137 Original CRISPR CGCCCACAGCCGTGCATTCC AGG Intronic
900604695 1:3518782-3518804 CACCCACAGCCCTGCCTTCTAGG + Intronic
900990465 1:6096140-6096162 GGCCCACAGCCCTGGGTTCCAGG + Intronic
901501009 1:9652547-9652569 CGCCCCCAGCTTTGCATTTCCGG + Intronic
903283506 1:22263459-22263481 CCCCAGCAGCCGTGCAGTCCAGG + Intergenic
904451948 1:30619020-30619042 CACCCACAGCCCTTCATCCCTGG + Intergenic
907831057 1:58064620-58064642 AGGCCACAGACTTGCATTCCAGG + Intronic
909953210 1:81745294-81745316 AGCACACAGCTGTGCATTCTTGG + Intronic
919916804 1:202144212-202144234 TGCCCCCAGCCGTGCAGTACCGG + Intronic
924801633 1:247332369-247332391 CGCTCACATCCGCGCCTTCCGGG + Intergenic
1066594738 10:37037916-37037938 CGCCCACCACCATGCATGCCCGG + Intergenic
1070691487 10:78530484-78530506 CTCTCACAGCCATGCAGTCCAGG - Intergenic
1076889362 10:133276360-133276382 AGCCCACACCCCTGCACTCCAGG + Intronic
1077194643 11:1273165-1273187 TGAGCACAGCCTTGCATTCCGGG - Intergenic
1091286089 11:134409384-134409406 TCCCCACTGCCCTGCATTCCAGG + Intronic
1097206753 12:57328610-57328632 GTCCCACAGCCTTGAATTCCTGG + Intronic
1100456484 12:94756524-94756546 CGCCCACAGGCCTGGGTTCCTGG - Intergenic
1104905568 12:132211874-132211896 AGCCCACAGGCGTGGATTGCAGG - Intronic
1105916581 13:24922688-24922710 CGCCCACCGCCGTCCATCTCCGG + Intronic
1108773229 13:53731106-53731128 CTCCCACAGCTGTGCACTCTAGG - Intergenic
1117302163 14:54440910-54440932 GGCCCGCGGCCCTGCATTCCCGG - Intronic
1118867337 14:69713705-69713727 CGGCCACAGCCCTGCTTTACCGG + Exonic
1122516301 14:102311197-102311219 CGCCCACCACCATGCATGCCCGG - Intergenic
1126793549 15:52242068-52242090 GGCCTACAGCCGAGGATTCCTGG - Exonic
1127397240 15:58552548-58552570 CACCCACGGCCCTGCACTCCAGG + Intronic
1132314093 15:100878474-100878496 CGGCCTCAGCTGTGCACTCCAGG + Intronic
1132585578 16:704689-704711 CCCCCACACCCGTGCATCCGAGG - Intronic
1134036426 16:11034643-11034665 CGCCCACAGCCCTGCCTTAGGGG - Intronic
1136013914 16:27382956-27382978 CGACCACAGCTGTGGATTCTGGG + Intergenic
1136070670 16:27785139-27785161 CGCCCACTTCCCTCCATTCCCGG + Intergenic
1136452261 16:30359987-30360009 AGCCCACAGCAGAGCACTCCAGG + Intronic
1137580853 16:49632624-49632646 CGCGCACAGCTGTGCATCCTTGG + Intronic
1141160375 16:81625639-81625661 CCCTCACAGCTGTGCATACCTGG - Intronic
1141995082 16:87631619-87631641 CGCTCACACCCTTCCATTCCAGG + Intronic
1141997618 16:87645430-87645452 CTCCCACAGCCCTGCAGTGCTGG - Intronic
1142384224 16:89752439-89752461 CACCCACATCCTTGCATTCTTGG - Intronic
1142898310 17:2996274-2996296 CTCTGACAGCCGTGCATCCCTGG + Intronic
1143018174 17:3902978-3903000 TGCCCACATCCGTTCATTCTGGG + Intronic
1144847040 17:18225542-18225564 CGCCCACCCCCGTGCAGGCCCGG + Intergenic
1150456696 17:65312115-65312137 AGCCCACAGCCTTGCTTCCCTGG + Intergenic
1151320166 17:73348226-73348248 GACACACAGCCCTGCATTCCAGG - Intronic
1151561201 17:74870700-74870722 TGCCCAAGGCCTTGCATTCCAGG + Intronic
1159031672 18:63238274-63238296 TGCCCACATCACTGCATTCCTGG - Intronic
1159266392 18:66086065-66086087 ACACCACAGCCTTGCATTCCTGG + Intergenic
1160213405 18:76903541-76903563 TGCCCACAGCTCTCCATTCCCGG - Intronic
1161448342 19:4330101-4330123 TGGGCACAGCCGTCCATTCCCGG - Intronic
1163820706 19:19494906-19494928 CACCCAGAGCCGTGCAAACCTGG - Intronic
1167616603 19:50537897-50537919 CGCCCTCTGCCGTCCGTTCCCGG - Intronic
925134101 2:1514562-1514584 CGCCCACAGCAGAGAACTCCAGG + Intronic
932219569 2:69989472-69989494 GGCCCACAGCCCCCCATTCCTGG - Intergenic
932460644 2:71879776-71879798 TGCCCACAGCAGCACATTCCAGG + Intergenic
932463981 2:71901718-71901740 CCACCACAACCCTGCATTCCTGG + Intergenic
936069281 2:109354419-109354441 GGCCCACAGCCCTGCTCTCCTGG - Intronic
941001588 2:160208224-160208246 TGCCCACAGTCGTGCTCTCCTGG - Intronic
942251278 2:174049433-174049455 CACCCACATCTGTGCCTTCCTGG + Intergenic
945673926 2:212832958-212832980 CGCCAACAGACGTGCAGCCCCGG + Intergenic
946176137 2:217922857-217922879 CGCCCACAGCCGTGCATTCCAGG + Intronic
1170852469 20:20017515-20017537 CGGCCCCAGCCGCGCCTTCCCGG + Intronic
1171232505 20:23498913-23498935 AGACCACAGCCCTGCCTTCCAGG + Intergenic
1172074401 20:32283109-32283131 CCCCCACAGCCTTGAACTCCTGG + Intronic
1175942939 20:62546273-62546295 CCGCCACAGCCGTGGATTCGGGG - Intergenic
1176447265 21:6831102-6831124 CGCCCACAACCCTGCAATCTGGG - Intergenic
1176825433 21:13696128-13696150 CGCCCACAACCCTGCAATCTGGG - Intergenic
1177900051 21:26903894-26903916 CCCCCACATCCTTGCATTCTAGG - Intergenic
1179654224 21:42835111-42835133 CGCCCACACCCCTGCCTCCCTGG - Intergenic
1179719460 21:43306997-43307019 CACCCACAGCAGTGCATCCATGG + Intergenic
1181041303 22:20193946-20193968 AGCCCACAGCCCTGCAGGCCGGG + Intergenic
1181373777 22:22440102-22440124 TGCTCACAGGCGTGCATTTCTGG + Intergenic
1185147711 22:49148287-49148309 CGGCCACAGCCCAGCAGTCCCGG + Intergenic
954410822 3:50370166-50370188 TGCACACAGCCGCGCATACCGGG + Intronic
956454123 3:69403968-69403990 TGCTCACAGCCTTGAATTCCTGG + Intronic
962314962 3:134353655-134353677 CGCAACCAGCAGTGCATTCCTGG - Intergenic
963179525 3:142339106-142339128 CGCCCACAGCCCGCCATACCTGG - Intronic
968912957 4:3485149-3485171 CGCCCACATACCTGCCTTCCGGG - Intronic
968941283 4:3640116-3640138 CACCCAGAGGCCTGCATTCCAGG - Intergenic
985376401 4:189344315-189344337 AGCCCACAGCCGTGGTTTACTGG - Intergenic
995142512 5:108749225-108749247 CGCCCGCAGCAGAGCATTCCTGG + Intronic
998116723 5:139543460-139543482 CGCCTACTGACGTGCAATCCAGG - Intronic
999350376 5:150864589-150864611 AGCCCACAGCCTACCATTCCAGG - Intronic
1003307917 6:4946011-4946033 CGCCCACAGGCGGGCCTCCCTGG + Intronic
1003641825 6:7882022-7882044 CTGCCACAGCCGTGCACACCAGG + Exonic
1006419429 6:33924084-33924106 AGCCCACAGCCGTGTACCCCTGG + Intergenic
1010810070 6:80290457-80290479 CGCCCACTGCGGAGCATGCCTGG + Intronic
1015099231 6:129455155-129455177 GGACCACAGCCTTGAATTCCTGG - Intronic
1019479556 7:1260232-1260254 AGCCCACACCCCTGCAGTCCAGG + Intergenic
1019485132 7:1285835-1285857 CCCCCCCAGCCCTGCCTTCCTGG + Intergenic
1024430088 7:49278330-49278352 GGCCCACAGGCATGCATACCAGG + Intergenic
1030189402 7:106795408-106795430 CTCTCACAGACGTGCACTCCAGG - Intergenic
1034986789 7:155521171-155521193 CACCCACAGCCGAGGATTCTTGG - Intronic
1039807282 8:41011135-41011157 TGCCCTCAGCCTTGCCTTCCTGG + Intergenic
1050105704 9:2164218-2164240 AGCCCACAGCCATGTATACCAGG - Intronic
1057801219 9:98192522-98192544 CGCCGCCGGCCGTGCCTTCCCGG - Intronic
1061064757 9:128270641-128270663 CGATCACAGGCCTGCATTCCTGG + Intronic
1061879760 9:133562760-133562782 CGCCCACAGCGGTGCGAGCCTGG - Intronic
1061879772 9:133562804-133562826 CGCCCACAGCGGTGCGAGCCTGG - Intronic
1061879798 9:133562894-133562916 CGCCCACAGCGGTGCAAGCCTGG - Intronic
1061879810 9:133562938-133562960 CGCCCACAGCGGTGCGAGCCTGG - Intronic
1061879822 9:133562983-133563005 CGCCCACAGCGGTGCGAGCCTGG - Intronic
1062219373 9:135406239-135406261 GGCCCACAGCTGTGTATGCCAGG - Intergenic
1062444005 9:136585827-136585849 TACCCACAGCCGTTCATCCCGGG + Intergenic
1203521925 Un_GL000213v1:53429-53451 CGCCCACAACCCTGCAATCTGGG + Intergenic
1185649054 X:1635501-1635523 CACCCAAAGCCGTGGATTCCAGG - Intronic
1199789027 X:151132691-151132713 AGGACACAGCCGTGCATGCCTGG + Intergenic
1199978264 X:152906907-152906929 CGCCTTCAGCCTTGCCTTCCCGG - Intergenic
1199980819 X:152919500-152919522 CTCCCACTGCTGTGCATGCCTGG - Intronic