ID: 946177861

View in Genome Browser
Species Human (GRCh38)
Location 2:217932850-217932872
Sequence GGCCCCTAGATGGCAGCGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946177856_946177861 27 Left 946177856 2:217932800-217932822 CCATGCATAAGCTTCAGTTATCT 0: 1
1: 0
2: 2
3: 11
4: 173
Right 946177861 2:217932850-217932872 GGCCCCTAGATGGCAGCGACAGG 0: 1
1: 0
2: 0
3: 5
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946177861 Original CRISPR GGCCCCTAGATGGCAGCGAC AGG Intronic
900314625 1:2050646-2050668 GGCCCCAAGATGGAAGGGAGCGG + Exonic
900382421 1:2391520-2391542 GGCGGCAAGATGGCAGCGGCGGG - Exonic
901091601 1:6645378-6645400 TGCTCCTAGGTGGCAGCGGCTGG + Intronic
901756405 1:11444069-11444091 GGCAGCTAGATGGGAGCCACTGG - Intergenic
903221123 1:21870231-21870253 AGCCCCCAGAGGGCAGGGACTGG - Intronic
907049313 1:51318795-51318817 GGCCCCCAGATGTCAGCACCCGG - Intronic
907930633 1:58996032-58996054 GTGGCCTAGATGGCAGAGACAGG + Intergenic
910908565 1:92209379-92209401 GGCCCCTTTATCGCAGCTACTGG + Intergenic
915570841 1:156744380-156744402 GGGCCCAGCATGGCAGCGACTGG - Intronic
1067008730 10:42690744-42690766 GGCCACTGGGTGGCAGTGACAGG + Intergenic
1068323513 10:55452364-55452386 GGACCCTAGAGGGCAGATACAGG + Intronic
1069262448 10:66415160-66415182 GGCCCCCAGATGGCATGTACAGG - Intronic
1070845923 10:79522684-79522706 GGCCCGGAGATGTCAGAGACAGG - Intergenic
1072191073 10:93076422-93076444 GGCCCCATGATGGGAGAGACTGG - Intronic
1074008921 10:109456970-109456992 GGACCCGAGGTGGCAGCGAGGGG + Intergenic
1076136081 10:128046412-128046434 AGCCCCTCGAAGGCAACGACCGG - Intronic
1077063379 11:627200-627222 GGCCCCTTTATGGCGGCGCCCGG + Intergenic
1077362614 11:2147385-2147407 GGCCCCTAGACGGAAGCACCTGG + Intronic
1083184610 11:61009843-61009865 GGACCCTGGCTGCCAGCGACTGG - Exonic
1084266615 11:68008425-68008447 GGCCCAGAGAGGGCAGCCACTGG - Intergenic
1084650165 11:70484894-70484916 TGCCCCAAGAGGGCAGCGAGTGG - Intronic
1084695945 11:70755687-70755709 GGCCACTAGATGGCAGCCGCGGG - Intronic
1086067073 11:82756923-82756945 GGCCACTAAATGGCAACGATGGG - Intergenic
1089642022 11:119853928-119853950 GGCCCACAGAGGGCAGCGACTGG - Intergenic
1101998118 12:109539611-109539633 GGCTCATAGATGGCACAGACTGG - Intergenic
1104379223 12:128292043-128292065 GACACCTAGATACCAGCGACAGG - Intronic
1107644437 13:42479404-42479426 GGCCCCGAGAGGGGAGAGACCGG + Intergenic
1114398405 14:22387587-22387609 GGCCACTAGATGGCAGCAGATGG + Intergenic
1114648487 14:24268740-24268762 GGACCCCAGATGGCAGGAACCGG - Exonic
1114656583 14:24319363-24319385 AGCACCTACATGGCAGCCACAGG - Exonic
1119606341 14:76021165-76021187 GGCCCCTAGATGGCATACATGGG + Intronic
1120838837 14:89065002-89065024 GGCTCCTAAATGGCAGCTTCTGG - Intergenic
1122249328 14:100427076-100427098 GGCCCCAAGGTGGCAGGGACAGG - Intronic
1125029917 15:35065992-35066014 GGGCCCTATATGGCAGTGACAGG + Intergenic
1126111769 15:45179410-45179432 GGCTCCTGGAGGGCAGGGACAGG + Intronic
1129097882 15:73227589-73227611 GGCCCTTAGGTTTCAGCGACTGG + Intronic
1131461875 15:92623212-92623234 GGCCCCTCGAGGGCAGGGCCAGG + Intronic
1132547777 16:541145-541167 GGCCCCCAGGTGGGAGGGACGGG + Intronic
1134128451 16:11632366-11632388 GGCACCGAGATGACAGAGACAGG + Intronic
1134837753 16:17376234-17376256 GGCACCTAGAGGGTAGAGACAGG + Intronic
1135202637 16:20451859-20451881 GGCACCTTTATGGCAGCAACAGG + Intronic
1136626355 16:31464554-31464576 GGCTCCTCGATGGCGGCGGCGGG - Exonic
1138015213 16:53421489-53421511 GGCGCCCACAGGGCAGCGACAGG + Intergenic
1138083266 16:54112011-54112033 GGCCCCTAGATTGTAGCACCCGG + Exonic
1141697226 16:85625825-85625847 GGGCCCTGGAGGGCAGCGTCTGG + Intronic
1142192176 16:88723094-88723116 GGCCCCGAGGAGGCAGCGGCAGG - Exonic
1142208150 16:88793702-88793724 GGCCCCAAGCTGGCAGTTACTGG + Intergenic
1142208164 16:88793743-88793765 GGCCCCAAGCTGGCAGTTACTGG + Intergenic
1142208178 16:88793784-88793806 GGCCCCAAGCTGGCAGTTACTGG + Intergenic
1145005671 17:19336419-19336441 GGCCCCAACATGACAGCCACTGG + Exonic
1146685593 17:34839483-34839505 GGCTCCTAGATTCCAGCCACAGG - Intergenic
1147720810 17:42538198-42538220 GGCTCCTTGATGGCAGCGTTCGG + Intronic
1154007902 18:10548813-10548835 GGCATCTAGAGGGCAGAGACCGG - Intronic
1154407542 18:14107956-14107978 GGCTCCTGGATGGCACCGATGGG + Intronic
1156474282 18:37395790-37395812 GGCCCCCACATGGCAGCCAGAGG + Intronic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1167491605 19:49795774-49795796 GGCCCCCAGATGCCAGCAGCAGG - Intronic
1167539133 19:50074274-50074296 GGCCCCCAGATGGCAGGGGATGG + Intergenic
926767918 2:16338388-16338410 GGCCCATTGATGGCAGCAGCAGG - Intergenic
934922945 2:98360249-98360271 GGCCACTAGGTGCCAGCCACAGG - Intronic
935281460 2:101521507-101521529 GGGCCCTAGAGGGCCGTGACAGG + Intergenic
936514557 2:113173711-113173733 GGCCCCTGCATGGCAGGGAGAGG + Intronic
946177861 2:217932850-217932872 GGCCCCTAGATGGCAGCGACAGG + Intronic
947902058 2:233729227-233729249 TGCCCATTGATGGCAGCCACTGG + Exonic
948154325 2:235769175-235769197 GGCCCCAAGGTAGCAGCAACAGG - Intronic
948857373 2:240736352-240736374 AGCCCCTGGAAGGCAGCGTCTGG + Intronic
1168835243 20:873310-873332 GGCCTCTAGAGGGCAGCAAGGGG + Intronic
1170089115 20:12570512-12570534 GACCCCTAGAAGGCAGCTGCTGG - Intergenic
1172529733 20:35621651-35621673 GGCTCCTTGAGGGCAGGGACTGG - Intergenic
1173915627 20:46706660-46706682 TGCCTCTAGATGGGAGCCACAGG + Intergenic
1174340484 20:49892115-49892137 GGCTCCTGCATGGCAGCCACAGG - Exonic
1176809697 21:13525276-13525298 GGCCCGCAGAGGGCAGCGGCTGG - Intergenic
1177223295 21:18221747-18221769 GGACCCTAGATGGCACTTACAGG + Intronic
1178345253 21:31820372-31820394 GGCCCCTAAAAGGCTGCCACAGG - Intergenic
1182715278 22:32353066-32353088 GGCCACTGGATGGCAGAGGCCGG + Intergenic
1183696559 22:39426953-39426975 GGCCCCCAGATGGCATCCCCAGG - Intronic
951646221 3:24894283-24894305 GGCCACTAGATGGTAGAGAGAGG - Intergenic
953981979 3:47417813-47417835 GGCCCCCAGCAGGCAGCGCCGGG - Exonic
962201534 3:133404368-133404390 AGCCCCTGGGTGGCAGCAACTGG + Intronic
967140574 3:186555016-186555038 GGCCCCTAGGATGCACCGACTGG - Exonic
968234020 3:197021318-197021340 GGACCCTAGATGGCAGAGTTGGG - Intronic
981572317 4:146165719-146165741 GGACTTTAGATGGCAGCGAGTGG + Intergenic
985996907 5:3602211-3602233 TGCCCTTAGATGGCCGCGGCCGG + Intergenic
986748183 5:10761705-10761727 AGAGCCCAGATGGCAGCGACGGG + Intergenic
991296777 5:65089996-65090018 GGATCCTAGGTGGCAGGGACTGG - Intergenic
995589326 5:113682858-113682880 GACCCCTTGCTGGCAGCCACAGG - Intergenic
996221335 5:120936739-120936761 GGCCCCTACAGCGCAGCGGCGGG - Intergenic
1005254084 6:23981368-23981390 GGCCCCTGAATGGCAGCAGCAGG - Intergenic
1007521014 6:42451975-42451997 GGCCCCGAGTGGGCTGCGACCGG - Intronic
1012189901 6:96266257-96266279 GGCCCATAGGAGGCAGGGACAGG + Intergenic
1013076565 6:106776939-106776961 GGCCCTTACATGGCAGAGAGAGG + Intergenic
1016937412 6:149457354-149457376 GGCCCCTAGCTGGGAGCCAGAGG + Intronic
1019512654 7:1425822-1425844 GGGCCCTGGATGTCAGCGAGGGG + Intergenic
1019712155 7:2522662-2522684 GGTCCCTAGAAGGCAGGGACTGG + Intronic
1020129732 7:5553012-5553034 GGCCCCTGGATGACAGGGAGAGG - Intronic
1023196379 7:37644034-37644056 GGCCTCTGGATGGCAGCAGCAGG - Intergenic
1039101780 8:33949116-33949138 GGCCCCCATATGGCAGCAAGTGG + Intergenic
1039804415 8:40986368-40986390 GGCCCCTCTATGGAAGCCACCGG - Intergenic
1049690951 8:143958655-143958677 GGCCTCCAGAGGGCAGCGGCAGG - Intronic
1049698553 8:143995599-143995621 AGCTCCCAGATGTCAGCGACTGG - Intronic
1049838928 8:144758023-144758045 GGCCCCTGGTTGGCTGCGTCTGG - Intergenic
1061036581 9:128117762-128117784 GGCCGCTAGGTGGCAGCAGCAGG + Intergenic
1061368966 9:130187285-130187307 GACCCAGGGATGGCAGCGACGGG - Intronic
1188063893 X:25633740-25633762 GGCCCCTAGATGGCATACTCTGG - Intergenic
1197988533 X:132292960-132292982 TGCCACTAGATGGCAGTGTCTGG + Intergenic