ID: 946178250

View in Genome Browser
Species Human (GRCh38)
Location 2:217935060-217935082
Sequence GAGAGGTCTGTGTAGTGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946178250_946178252 0 Left 946178250 2:217935060-217935082 CCGCGGCACTACACAGACCTCTC 0: 1
1: 0
2: 0
3: 4
4: 93
Right 946178252 2:217935083-217935105 TCTCTGCCCCAAGTCAGAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946178250 Original CRISPR GAGAGGTCTGTGTAGTGCCG CGG (reversed) Intronic
900278541 1:1849818-1849840 CAGAGGTCTGTGAAGTTCAGAGG - Intronic
900471475 1:2857069-2857091 GGGAGGTCTGTGTGCTGCAGTGG + Intergenic
900656654 1:3762053-3762075 GGCAGGTCTGTGTTGTGCCCAGG + Intronic
901185453 1:7369857-7369879 GAGAGGTCTGGGCTGTGCCCTGG - Intronic
902948097 1:19858184-19858206 GAGAGGTGTGAGCAGTGCCAGGG - Intergenic
903191979 1:21662057-21662079 GAGAGGTCTGTATGGGGCCAGGG - Intronic
904040582 1:27582139-27582161 GAGGGGTGTGGGCAGTGCCGAGG - Intronic
906127595 1:43437107-43437129 GAGAAGTCTGTGGAGGGCAGAGG + Intronic
906943523 1:50276218-50276240 GTGAAGTCTGTGAAGGGCCGGGG - Intergenic
914960251 1:152199073-152199095 AATAGGTCAGTGTAGTGCCATGG + Intergenic
915949749 1:160181228-160181250 GAGACATCTGTGAAGTGCTGTGG + Intronic
916077323 1:161209408-161209430 GAGAGGTCTGGGCAGAGCCTGGG - Intronic
1067290233 10:44934742-44934764 GAGGGGTCTGTGTACTGCTCTGG - Exonic
1067776980 10:49170983-49171005 CAGAGGTCTCTGGAGTGCCTCGG + Intronic
1073147034 10:101287897-101287919 GAGAGGTCAGGGTGGTGCCCAGG - Intergenic
1073509585 10:104034788-104034810 GAAAGGTCGGGGTAGTGCTGCGG + Intronic
1077143837 11:1036204-1036226 GAGAGGTCTCTGGAGTGTGGGGG - Intronic
1082870352 11:57938716-57938738 GAGAGGTCAGTGTAGTCACCAGG + Intergenic
1085339834 11:75723947-75723969 GGGAGGTTTGTGAAGTGCTGTGG - Intronic
1086910849 11:92470148-92470170 GAGAGGTCTGGGTTCTGCCTCGG - Intronic
1091800125 12:3319881-3319903 GGTAGGTCTGTGTGGAGCCGTGG - Intergenic
1092131448 12:6116141-6116163 TGGAGGTCTGTGGAGTGCAGGGG - Intronic
1092963961 12:13624019-13624041 GAGAGGTCTGAGAAGGGCCAAGG - Intronic
1093077791 12:14775032-14775054 GAGAGAGCTGTGTAGTCGCGGGG + Intronic
1096069267 12:48765904-48765926 GAGAGGTCTGTGAGGGGCCAAGG + Intergenic
1103712617 12:122924045-122924067 GAGAGGTCTCTGAAGTGACTTGG - Intronic
1110132920 13:72029289-72029311 GGGGGGTCTGAGTAGTGCTGGGG - Intergenic
1113390611 13:109892934-109892956 GAGAGGTCTGTGCAGGGCACTGG + Intergenic
1113456745 13:110454918-110454940 GAGAGGTCTGTGGGGTGGCAGGG - Intronic
1117905009 14:60575735-60575757 CAGAGGTCTGTGAAGTTCCCGGG - Intergenic
1120478319 14:85017560-85017582 GAGAGGTATGGGAAGTGCCTAGG + Intergenic
1121285930 14:92735846-92735868 GATAGGTCAGTGGAGTGCTGGGG + Intronic
1123173132 14:106392772-106392794 GATAGGTCTGTGTATTACTGTGG - Intergenic
1123424203 15:20156011-20156033 GTGAGGCCTGAGCAGTGCCGAGG + Intergenic
1123533424 15:21162540-21162562 GTGAGGCCTGAGCAGTGCCGAGG + Intergenic
1128744540 15:70104129-70104151 GAGTGTTCTCTGTAGTGCCCTGG - Intergenic
1129255758 15:74333134-74333156 GAGAGGCCTGTGTAGGGTCCAGG - Intronic
1129764077 15:78149841-78149863 GAGAGGTGTGGGCAGTGCTGAGG - Intronic
1132765005 16:1529976-1529998 GAGACGTCTGTGAGGAGCCGTGG - Intronic
1133934760 16:10259734-10259756 TAGGGATCTGTGTAGTGCAGTGG - Intergenic
1135113377 16:19707721-19707743 GAGTGCTCTGTGTAGGGTCGTGG - Intronic
1135929979 16:26728092-26728114 GGGAGGTCTATGCAGTGCCCTGG + Intergenic
1142800698 17:2343645-2343667 GGGAGGTCGGTCTAGAGCCGAGG + Intronic
1147586692 17:41657178-41657200 GAGAGGCCTCTGTAATGCGGGGG + Intergenic
1149413425 17:56432698-56432720 GGGAGGTCTGTGCAGTGGCCAGG - Intronic
1153604657 18:6819723-6819745 GAGAGATCTCTGTAGTCCCATGG + Intronic
1157310906 18:46552569-46552591 GAGAGCTCTGTGTGGTCCAGGGG - Intronic
1158273468 18:55741607-55741629 GAGAGGTCTGTATATGGCCAAGG - Intergenic
1160264064 18:77323527-77323549 GAAAGGTGTGTGCAGTGCCGAGG + Intergenic
1160299872 18:77669743-77669765 GAGAAGGCTGTGTGGTGACGGGG + Intergenic
1160658617 19:287902-287924 TGGAGGTCTGTGTGGGGCCGGGG - Intronic
1160776694 19:859772-859794 GACAGGGCTGTGTAGGGGCGTGG + Intronic
1167175777 19:47863549-47863571 GAGAGGGGTGTGGAGTGCTGAGG - Intergenic
925320425 2:2962252-2962274 GAGCAGTATGTGTAGTGCAGTGG - Intergenic
928206478 2:29288174-29288196 GACAGGTCTGAGTAGGGCAGGGG + Intronic
929549333 2:42879537-42879559 GAGAGGTGTGTGTGGGGTCGAGG + Intergenic
933933593 2:87180658-87180680 GAGATGTCTGTGGAATGCAGGGG + Intergenic
936359518 2:111784786-111784808 GAGATGTCTGTGGAATGCAGGGG - Intronic
938176898 2:129142044-129142066 GAGTGTTCTGTGTGGTGCCTGGG + Intergenic
941520008 2:166530423-166530445 GAGAGTTCTGTGAAATGCAGGGG + Intergenic
942882805 2:180883180-180883202 CAGAGGTCTGTGTCCTGCCTTGG + Intergenic
946178250 2:217935060-217935082 GAGAGGTCTGTGTAGTGCCGCGG - Intronic
947810543 2:233001228-233001250 GAGAGGTCTGTCTCATGCCTAGG - Intronic
948507106 2:238435721-238435743 GAGAAGTCTGTCTGGTGCTGTGG + Exonic
1172153527 20:32807775-32807797 GACACGTCTGTGTAGTGCACAGG - Exonic
1178462252 21:32813619-32813641 CAGAGGTCTGTGGAGTGGAGAGG - Intronic
1179771778 21:43625025-43625047 GATAGGTTAGTGTAGTGCAGAGG - Intronic
1179937722 21:44615800-44615822 GATAGGTCTGTGCACTGCCCTGG + Intronic
1182524014 22:30904262-30904284 GAGAGTTCTGTGGATTGCGGAGG - Intronic
1184464487 22:44660743-44660765 GAGAGGTCTGTGTGGGGCCCAGG + Intergenic
950663449 3:14481188-14481210 GAGAGGTATGGGTGGTGCCTGGG + Intronic
953244903 3:41182322-41182344 GAGAGGTTTGTGAATTGCCCAGG + Intergenic
954363604 3:50134934-50134956 GGGAGCTCTGTGGAGAGCCGGGG - Intergenic
955217779 3:56998603-56998625 GAGTGGTCTGTGAAGTCCCTGGG - Intronic
960094693 3:113677925-113677947 GAGAGGTCTGGGTAGGGCCCAGG + Intronic
961090520 3:124107420-124107442 GAAAGGTCTGTATATTACCGAGG - Intronic
965596198 3:170413800-170413822 GAGGGGTCTCTGTATTGCCCAGG - Intergenic
968001145 3:195207580-195207602 GAGAGAGCTGTGAAGTGCCAAGG - Intronic
978619373 4:110623145-110623167 GAGAGGGCTGGGGAGGGCCGCGG - Intronic
989567730 5:42917375-42917397 GAGATGTCTGGGCAGTGCAGGGG - Intergenic
990768147 5:59210569-59210591 GAGATATCTGTATAGTGCCTGGG + Intronic
1000139234 5:158385276-158385298 GAGAGGTTTGTCCAGTGCAGGGG + Intergenic
1003527395 6:6909676-6909698 GCGAGGTCTGTGGAGTGGCAGGG - Intergenic
1004814863 6:19301888-19301910 TAGAGGTATGTGTGGGGCCGGGG + Intergenic
1018368818 6:163149275-163149297 GAGAGGCCTGGGGAGGGCCGGGG - Intronic
1022097559 7:27150506-27150528 GAGAGGGCTGTGAAGGGCAGAGG - Intronic
1022136751 7:27456693-27456715 GAGAGTTCTGTGGATTGCTGAGG + Intergenic
1022164042 7:27740389-27740411 GAGAGGTCTCTGTGGTGACGAGG + Intronic
1026644201 7:72153742-72153764 GGGAGGTCTGTATGGTGCCCTGG + Intronic
1026926388 7:74196756-74196778 GAGAGTTCTGTGGATTGCTGAGG - Exonic
1035296401 7:157869229-157869251 GGGAGGTCTGGGTAGGGCCTTGG + Intronic
1035664979 8:1374135-1374157 CAGAGGGCTGTGTAGTGTGGAGG + Intergenic
1037936459 8:22918126-22918148 GAAAGGTCCGAGTAGTGCCCAGG + Intronic
1044430765 8:92103510-92103532 GAGACATCTGTGTTGTGCGGGGG + Intergenic
1051605255 9:18911952-18911974 GACAGGCCTGTGGTGTGCCGGGG - Intergenic
1059123573 9:111662777-111662799 GAGAGGGCTGTGGAATGCAGAGG + Intronic
1060552820 9:124493663-124493685 GAGAGCTCTGCGTAGGCCCGGGG - Intronic
1062044555 9:134419002-134419024 TAGAGGTCTGAGCAGAGCCGGGG - Intronic