ID: 946179541

View in Genome Browser
Species Human (GRCh38)
Location 2:217941372-217941394
Sequence GGCAAGGGGCAGAGTGGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 738
Summary {0: 1, 1: 0, 2: 7, 3: 81, 4: 649}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946179531_946179541 2 Left 946179531 2:217941347-217941369 CCACACTGTCACGCAGCCCACCA 0: 1
1: 0
2: 2
3: 15
4: 197
Right 946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG 0: 1
1: 0
2: 7
3: 81
4: 649
946179530_946179541 10 Left 946179530 2:217941339-217941361 CCTCAACTCCACACTGTCACGCA 0: 1
1: 0
2: 0
3: 12
4: 181
Right 946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG 0: 1
1: 0
2: 7
3: 81
4: 649
946179528_946179541 12 Left 946179528 2:217941337-217941359 CCCCTCAACTCCACACTGTCACG 0: 1
1: 0
2: 0
3: 4
4: 136
Right 946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG 0: 1
1: 0
2: 7
3: 81
4: 649
946179527_946179541 29 Left 946179527 2:217941320-217941342 CCTGTGGTGCTTGCTGTCCCCTC 0: 1
1: 0
2: 2
3: 21
4: 204
Right 946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG 0: 1
1: 0
2: 7
3: 81
4: 649
946179529_946179541 11 Left 946179529 2:217941338-217941360 CCCTCAACTCCACACTGTCACGC 0: 1
1: 0
2: 0
3: 4
4: 120
Right 946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG 0: 1
1: 0
2: 7
3: 81
4: 649

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946179541 Original CRISPR GGCAAGGGGCAGAGTGGGCC AGG Intronic
900115177 1:1025199-1025221 GGCCAGGGTCAGAGTGAGTCTGG + Intronic
900138436 1:1128691-1128713 GGCGGAGGGCAGTGTGGGCCAGG - Intergenic
900143820 1:1149608-1149630 GGGAAGGGGCAGAGGAGGGCAGG + Intergenic
900143853 1:1149690-1149712 GGGAAGGGGCAGAGGAGGGCAGG + Intergenic
900228766 1:1545324-1545346 GGCCAAGGGCAGCTTGGGCCGGG - Intronic
900373737 1:2343982-2344004 GGCCAGGGGCAGGGTGGGGTGGG + Intronic
900592301 1:3465481-3465503 GGCACGGGGCTGAGGGTGCCAGG + Intronic
900671409 1:3857147-3857169 GGCTATGGGCAGAGGTGGCCGGG - Exonic
900947600 1:5840202-5840224 GGCAGGGGGCAGAGCTGCCCAGG + Intergenic
900951037 1:5858443-5858465 GGCAGGGGGTCGAGTGGGCCAGG - Intergenic
901219405 1:7574660-7574682 GGCACGGGACAGAGCTGGCCAGG - Intronic
901235694 1:7666525-7666547 GGAAGGGGACAGAGTGGCCCAGG + Intronic
901675575 1:10881744-10881766 GGCAAGGGCAAGAGTGGACGTGG - Intergenic
901810478 1:11764470-11764492 GGCAAGAGGCTTAGTGGGCCTGG + Exonic
901908233 1:12433088-12433110 GGCATGTGGCAGAATGAGCCAGG + Intronic
902199656 1:14823816-14823838 GGCCAGGGAATGAGTGGGCCCGG + Intronic
902403836 1:16172506-16172528 GGCTAGGGACGGAGGGGGCCTGG - Intergenic
902429473 1:16352164-16352186 GGCAAGGGGCAGCGGGCGCCCGG - Intronic
902530225 1:17086113-17086135 GGGAGGGGTCAGAGTGGGGCAGG + Intronic
902591948 1:17481519-17481541 GCCAAGGGGCAGAGTGAGGGAGG + Intergenic
902836664 1:19051844-19051866 GGGAAGGGGCAGAATGAGCCTGG - Intergenic
903020063 1:20387340-20387362 GGCAGAAGGCAGAGAGGGCCTGG + Intergenic
903295516 1:22340908-22340930 GGCAAGGGGTAGAAAGGGCATGG + Intergenic
903447784 1:23433361-23433383 GGAAAGAGCCAGATTGGGCCTGG - Intronic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903986954 1:27235125-27235147 GGCGGAGGGCAGAGTGGTCCGGG + Intronic
904587131 1:31586775-31586797 GGCGAGGGGAAGAGGGGGCGGGG - Intronic
904748281 1:32724839-32724861 GGCAGGGCACAGAGTGGGGCAGG + Intergenic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
904982443 1:34518143-34518165 GGCAAGGGGCAGAGTCAGGCTGG - Intergenic
904985802 1:34547443-34547465 GGGAAGGGGCAGGGAGGGCAGGG + Intergenic
905022099 1:34825233-34825255 GGAAGGGGCCAGAGTGGGACTGG - Intronic
905447536 1:38036810-38036832 GGCAAGGTGCAGGGGGGTCCTGG - Intergenic
905881880 1:41469184-41469206 GGCCAGGGGCAGATGGGGGCCGG + Intergenic
906109183 1:43312075-43312097 GGGAAGGAGGAGAGGGGGCCTGG + Exonic
906322682 1:44826816-44826838 AGCACGGGGCAGAGTGGGCAGGG + Intronic
906647748 1:47488061-47488083 GGCATGGGGCAGGGTGAGCCAGG + Intergenic
907405244 1:54250077-54250099 GGCAAGGGGCAGAGTAGGAGCGG - Intronic
907454336 1:54565486-54565508 GGCAAAGGGGAGACTGGACCTGG - Intronic
907732676 1:57082960-57082982 GGCCAGGGGTTGAGTGGGTCGGG + Intronic
908282354 1:62553950-62553972 GTCAAGGGGCAGAGTAGGAGAGG - Intronic
909364099 1:74799343-74799365 GGCTGGAGCCAGAGTGGGCCTGG + Intergenic
909541140 1:76792786-76792808 AGCAAGGGGCAGTGTGGGAAAGG - Intergenic
910239974 1:85075766-85075788 GGCAATAAGAAGAGTGGGCCTGG - Intronic
912492519 1:110070140-110070162 GGCAAAGGCCAGTGTGGGGCGGG - Intronic
913146341 1:115993817-115993839 GGTAAAGTGCAGAGTGGGGCTGG - Intronic
913571526 1:120124988-120125010 AGCAAGAGGAAGAGGGGGCCTGG + Intergenic
914240306 1:145848663-145848685 GGAAAGGTGCAGAATGAGCCAGG + Exonic
914292447 1:146286609-146286631 AGCAAGAGGAAGAGGGGGCCTGG + Intergenic
914508244 1:148307842-148307864 CACAAGAGGCAGTGTGGGCCAGG + Intergenic
914553491 1:148737392-148737414 AGCAAGAGGAAGAGGGGGCCTGG + Intergenic
915073667 1:153292424-153292446 GGCCAGGGGCAGGGTGGCTCTGG - Intergenic
915294330 1:154909542-154909564 AGCAAGAGGAAGAGTTGGCCAGG + Intergenic
915893663 1:159794449-159794471 GACAAAGGGAAGAGTGGGCCAGG + Intergenic
915950777 1:160188638-160188660 GGAAAGGGGAAGGGTGGGACTGG + Intergenic
916863674 1:168833607-168833629 GGGAAGGGGCAGAGTGGTATTGG - Intergenic
916990467 1:170238099-170238121 GGGCAGGAGCACAGTGGGCCGGG + Intergenic
918313720 1:183305292-183305314 GGCAGGGGGTGGAGTGGGGCAGG + Intronic
920376833 1:205513309-205513331 GGCAAGGGCCAGGATAGGCCTGG - Intronic
920524953 1:206659554-206659576 GGCCAGGGAGGGAGTGGGCCAGG + Intronic
920701215 1:208219248-208219270 AGCCAGGGGCAGTCTGGGCCAGG + Intronic
921708696 1:218352097-218352119 GGCAAGGGGCAGGGGGAGGCGGG - Intronic
922340058 1:224647844-224647866 GCACAGGGGCTGAGTGGGCCAGG + Intronic
923499276 1:234550972-234550994 GGCAAGGTGCAGGTTGGCCCAGG - Intergenic
924942967 1:248825213-248825235 GGCAGGGGGCAAAGGGGGCTTGG + Exonic
1064388326 10:14919635-14919657 GGCCTTGGGCAGAGTGGACCTGG - Intronic
1064904184 10:20327815-20327837 AGCAATGGGCACAATGGGCCTGG + Intergenic
1065845381 10:29738745-29738767 GGCAGAGGGCAGACTGGGCAAGG - Intergenic
1065928110 10:30454131-30454153 GGCATGGGGCTGAGTGGCTCAGG - Intronic
1065946255 10:30607921-30607943 GCCAGGAGGCTGAGTGGGCCTGG + Intergenic
1066961774 10:42232505-42232527 GGCCAGGGCCAGGGAGGGCCAGG + Intergenic
1067530263 10:47066063-47066085 GGCAAGGAGCAGGGTGGGGAAGG - Intergenic
1068015842 10:51515776-51515798 TGCAAGGGGTTGAGTGGGCCAGG - Intronic
1068117747 10:52752618-52752640 GGGGATGGGCATAGTGGGCCAGG + Intergenic
1069576468 10:69533514-69533536 GGGAAGGGGGAGAGTGGGCAAGG + Intergenic
1069678909 10:70269866-70269888 GGCAAAGGGGAGAGTGGCACTGG - Intronic
1069714958 10:70514755-70514777 TGCAGTGGGCAGAGTGCGCCTGG + Intronic
1069742708 10:70695670-70695692 GACAAGGGGAGGAGTGGGTCTGG + Intronic
1069862319 10:71479478-71479500 TGCAAGGGGCAGAGTGGATTTGG + Intronic
1069879724 10:71584261-71584283 GGCAAGGGGTTGAGTGGGGTGGG + Intronic
1069887637 10:71634112-71634134 GGCAGGGAGCAGGGAGGGCCAGG - Intronic
1070378873 10:75861441-75861463 GTCAAGAGGCAGAGTGGGACTGG + Intronic
1070721740 10:78761660-78761682 GACATGAGGCAGAGTGTGCCAGG + Intergenic
1070960424 10:80495922-80495944 GGGAAGGGGTAGGGTGGGGCAGG - Intronic
1071086837 10:81875272-81875294 GGCATGGGGCCGCGCGGGCCGGG - Intergenic
1071103651 10:82068699-82068721 GGAAAGGGGGAGAGTGTTCCAGG + Intronic
1071171855 10:82875651-82875673 GTAAAGGGAGAGAGTGGGCCAGG - Intronic
1071601732 10:86961815-86961837 GCCAAGGGGCAGGATGGCCCTGG + Intronic
1071878253 10:89865981-89866003 GGAAAGGGGCAGAGAGGGAATGG + Intergenic
1072562072 10:96586378-96586400 GGCAACGGGCAGGCTGGGCTCGG - Intronic
1072636320 10:97180712-97180734 GGAAAGGGGCAGAGATGCCCAGG + Intronic
1073176390 10:101560027-101560049 GGCCAGAGCCAGGGTGGGCCTGG - Intergenic
1073250438 10:102117737-102117759 AGCAAGAGGCTGAGGGGGCCAGG - Intronic
1073538299 10:104297368-104297390 GGGAAGGGACAGAGGTGGCCAGG + Intronic
1073941201 10:108700404-108700426 GGCAAGGGACAGAGAGGGAGAGG + Intergenic
1074335950 10:112575982-112576004 GGCAGGGGGCAGGGTGGGAATGG - Intronic
1075451722 10:122556534-122556556 GGCAAGGGGGAGAGAGAGGCAGG + Intergenic
1075621636 10:123932582-123932604 TGCAAGGAGCAGAGTGGGACAGG - Intronic
1076036633 10:127204076-127204098 GGCAAGGGGGAGAAGGTGCCAGG - Intronic
1076058245 10:127392774-127392796 GGCACGTGGCAGAGTGGGGTGGG - Intronic
1076746407 10:132517028-132517050 GGCCAGGGCCACAGTGGGGCGGG + Intergenic
1076811078 10:132886689-132886711 GGAAGGTGGCAGAGTGGGCTGGG - Intronic
1076883915 10:133252595-133252617 GGTCAGGAGCAGAGTGGGACAGG - Intergenic
1076982856 11:214180-214202 GGGAAGGGGCCCAGTTGGCCAGG - Intronic
1077104086 11:834464-834486 CCCAAGGGCCAGAGTGGGCCGGG - Intronic
1077134368 11:991258-991280 GGCAAGGTGCCGAGTAGGCAGGG - Intronic
1077142749 11:1031577-1031599 GAGAAGGGCCAGGGTGGGCCTGG - Intronic
1077353767 11:2105245-2105267 GGTAAGGCTCAGACTGGGCCTGG - Intergenic
1077373843 11:2195954-2195976 GGCAGGGGTCAGCTTGGGCCTGG + Intergenic
1077394669 11:2315163-2315185 GGGAGGGGGCAGGGTGGGCTGGG - Intronic
1077438879 11:2559055-2559077 GACAAGGGGCAAGGTGGGGCTGG + Intronic
1077478715 11:2803101-2803123 GGTGAGGGGCAGAGTGAGCAAGG + Intronic
1077753137 11:4995919-4995941 GGAAAGGGGCTTAGGGGGCCCGG + Intergenic
1078180162 11:9004310-9004332 GGCCAGCGGCAGAGATGGCCGGG - Intergenic
1078457051 11:11483563-11483585 GGCCAGGAGCAGGCTGGGCCAGG - Intronic
1078498190 11:11841695-11841717 GGCAGGGAGGACAGTGGGCCTGG + Intronic
1078863855 11:15278517-15278539 GGAAAGGGGAAGAGAAGGCCAGG + Intergenic
1079145899 11:17851549-17851571 GGCAAGGGACAGACAGGACCTGG + Intronic
1080785617 11:35472681-35472703 GTCATGGGGCAGAGTGGTCCAGG + Intronic
1081679929 11:44994939-44994961 GGCAGGGGGCCACGTGGGCCTGG + Intergenic
1081914030 11:46719518-46719540 GGCAAGGGGCAGTGTAGGAGGGG + Intronic
1083266676 11:61550191-61550213 GGCAAGAGGAGGCGTGGGCCAGG - Intronic
1083610151 11:64000595-64000617 TGGAAGGGACAGGGTGGGCCGGG - Intronic
1083646586 11:64174963-64174985 GGGAAGGGCCTTAGTGGGCCAGG + Intergenic
1083703654 11:64498347-64498369 GGCGAGGGTCACAGTGGGGCGGG - Intergenic
1083735184 11:64676120-64676142 GGCAGCGGGCAGAGAGGGCAGGG + Intronic
1083761944 11:64823610-64823632 GGGAAGGGCCAGAGTGTGCCCGG + Exonic
1084191992 11:67503641-67503663 GGCAGTGAGAAGAGTGGGCCAGG - Intronic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1084538733 11:69774166-69774188 GCCGAGGGGCGGAGTGGGCCAGG - Intronic
1085034779 11:73293293-73293315 GGGCAAGGGCAGAGTGGCCCTGG + Intronic
1085098415 11:73779598-73779620 GGCAAGGGGCGGGGTTGGCCTGG + Intergenic
1085275061 11:75293065-75293087 GGCAAGGGGCACAGTGAGGGTGG + Intronic
1085403581 11:76248602-76248624 GGCTGGGGCCAGAGAGGGCCAGG + Intergenic
1085512146 11:77093818-77093840 GGCCTCGGGCAGAGTGGGCAGGG + Intronic
1088591968 11:111411304-111411326 GGCAAGGGGGTCAGTGTGCCTGG - Intronic
1089093415 11:115897776-115897798 GGGAAGGGGTAGGGTGGGCGGGG - Intergenic
1089581362 11:119483619-119483641 GGCACTGGGCAGAGAGGCCCAGG + Intergenic
1089785662 11:120905199-120905221 GGCCAGGGGCACAGAGGGTCGGG - Intronic
1090077433 11:123588091-123588113 GGCAGAAGGCAGAGTGGGACGGG - Intronic
1090990749 11:131815161-131815183 CGCAAGGGGATGAGAGGGCCGGG - Intronic
1091010579 11:131997235-131997257 GGCGAGAGGCTGGGTGGGCCAGG - Intronic
1091108315 11:132943188-132943210 GGGAAGGGGCAGAGTTCGCCAGG + Exonic
1091550814 12:1533759-1533781 GGCCAGGGGTGGAGAGGGCCTGG - Intronic
1091915843 12:4271458-4271480 GGCAAGGGACAGAGGCCGCCGGG - Intergenic
1092106129 12:5922739-5922761 GGCAGGGTCCAGAGGGGGCCAGG - Exonic
1092286623 12:7132408-7132430 GGGAGGGGGCAGAGAGGGGCAGG - Intronic
1093525369 12:20098928-20098950 GGAAAGGTGCTGAGTGGGCCAGG - Intergenic
1094375500 12:29784060-29784082 GGCCGGGGGCAGAGGGCGCCGGG - Intronic
1094719994 12:33053112-33053134 GGCAAGGGGCCAGGAGGGCCGGG - Intergenic
1096149722 12:49301272-49301294 GGCAGGTGGCAGAGCAGGCCAGG - Intergenic
1097193270 12:57230386-57230408 GGGAAGAGGCAGAGTTGGCAAGG - Intronic
1101083177 12:101209476-101209498 GGTAAGGGGCAGGGTGGGCTGGG - Exonic
1101967248 12:109290171-109290193 GGCAAGTGGCCGCGTGGACCTGG - Exonic
1102471810 12:113163590-113163612 GGCCAGGCGCAGAGAGGGGCAGG - Intronic
1102544605 12:113645654-113645676 GGCCAGGGGCAGAGAGGGCTGGG - Intergenic
1102858969 12:116319027-116319049 GGCATGGGGGAGAGAGGGACTGG + Intergenic
1103080089 12:118016913-118016935 GGCGGTGGGCAGAGGGGGCCAGG + Intronic
1103155944 12:118684987-118685009 GGGAAGGGAGAGAGTGGGCTAGG + Intergenic
1103606185 12:122087640-122087662 GGCAAGGGGCCTTGTGGGCCAGG + Intronic
1103726504 12:122999874-122999896 GGGGAGGGGCAGAAGGGGCCTGG - Intronic
1104072384 12:125356875-125356897 GGCAAGAGGCCCAGTGGGGCAGG - Intronic
1104411310 12:128560345-128560367 GGTAAGGTCCAGAGTGGGCAGGG - Intronic
1104836282 12:131793905-131793927 GGCTCGGGGGAGAGTGGGCACGG + Intronic
1105265827 13:18814229-18814251 AGGGAGGGACAGAGTGGGCCAGG - Intergenic
1105432045 13:20345322-20345344 GGCCAGGAGGAGAGTGGTCCAGG + Intergenic
1106017682 13:25884803-25884825 GGCAAGTGCCTGAGTGGGGCAGG - Intronic
1106303287 13:28488609-28488631 GGGAATGTGCAGTGTGGGCCGGG + Intronic
1107006732 13:35620449-35620471 GGCAAGGAGGCCAGTGGGCCAGG + Intronic
1107985681 13:45774280-45774302 GGTTAGGGGCAGAGTTGGCAAGG + Intergenic
1109109935 13:58303945-58303967 GTCAAGAAGCAGAGTTGGCCGGG + Intergenic
1110013450 13:70368088-70368110 GGCCAGGTGCTGAGTGGGGCAGG + Intergenic
1112331890 13:98483147-98483169 GGCACGGGGCAGCCTGGGCAGGG + Intronic
1112489461 13:99848690-99848712 AGCAAGGGGCACAGGGAGCCGGG - Intronic
1113378928 13:109786102-109786124 GGCGAGGGGCGGAGGGGGCGCGG + Exonic
1113444435 13:110354888-110354910 CGGCAGTGGCAGAGTGGGCCTGG + Intronic
1113672044 13:112182242-112182264 GGCAAGGGCCAGAGACAGCCAGG + Intergenic
1114535144 14:23417868-23417890 GGCCAGGGTCAGAGGGTGCCTGG - Intronic
1117396641 14:55317150-55317172 GGGAAGGGGTAGAGTGGGCTCGG + Intronic
1117499929 14:56341502-56341524 GGGACTGGGCAGAGTGGGCAGGG + Intergenic
1117711482 14:58533811-58533833 GGCAAGGGGGAGAGAGGGAGAGG - Intronic
1118994102 14:70821826-70821848 CGCAAGGGGCGGAGAGGGCCCGG - Intergenic
1119511558 14:75215545-75215567 GGGCAGGGGCAGGGTGGGCAGGG + Intergenic
1119696550 14:76718026-76718048 GGCAGGGAGCAGAGTGAGGCTGG - Intergenic
1119895343 14:78215190-78215212 GGAGAGGGCCAGAGTGGGCTCGG - Intergenic
1119898730 14:78242631-78242653 GGCCAGGGACAGGGAGGGCCGGG - Intronic
1120349946 14:83342566-83342588 GGGTATGGGCAGAGTGGGCCTGG + Intergenic
1121096183 14:91219669-91219691 GCCAAGGGCCAGAGTGGGCAGGG - Intronic
1121319886 14:92986084-92986106 GGAAAGGTGCTGAGTGGTCCTGG + Intronic
1121398287 14:93647636-93647658 GGGAAGAGGCAGTGTGAGCCAGG + Intronic
1121561993 14:94882770-94882792 GGCTAGGGGCTGAGTGGACAGGG - Intergenic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1122024935 14:98868945-98868967 GGCATGGGCCAGAATGGGCCTGG - Intergenic
1122053929 14:99079467-99079489 GGGAAGGGCCAGTGTGAGCCTGG - Intergenic
1122124207 14:99570477-99570499 GGCAGGGGCCAGAGGGGCCCAGG + Intronic
1122141189 14:99664045-99664067 TGCAAGGGACAGAGTGGGAGGGG + Intronic
1122256903 14:100485060-100485082 GGCAAGGAGCCTAGTGGGGCTGG - Intronic
1122310708 14:100792363-100792385 GGAGAGGGGCAGGGTGGGGCCGG - Intergenic
1202832684 14_GL000009v2_random:53883-53905 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1123476376 15:20594682-20594704 GGCAAGGGCCAGAGATGCCCTGG - Intergenic
1123562754 15:21513237-21513259 GGCAGGGGGCAGGGTGGGTTGGG - Intergenic
1123598998 15:21950520-21950542 GGCAGGGGGCAGGGTGGGTTGGG - Intergenic
1123630554 15:22257593-22257615 GGGAGGGGGGAGGGTGGGCCCGG + Intergenic
1123641635 15:22405682-22405704 GGCAAGGGCCAGAGATGCCCTGG + Intergenic
1124035552 15:26050756-26050778 TGCAAGGAGTTGAGTGGGCCTGG - Intergenic
1124240340 15:28023114-28023136 GGAACCGGGCAGGGTGGGCCAGG - Intronic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1124881108 15:33643551-33643573 GGCGAGGAGGAGAGTGGGCTAGG + Intronic
1125467226 15:39965990-39966012 GGCAAGGGGCAAAGAGGTACTGG - Intronic
1125519412 15:40339777-40339799 GGCCAGGGGTAGGGTGGGCATGG - Intronic
1125600490 15:40912896-40912918 TGCAAGGGAGAGAGTGGTCCTGG - Intergenic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1125898788 15:43326312-43326334 GGCAAGGCGATCAGTGGGCCAGG - Exonic
1125899240 15:43329929-43329951 GGCCAGGAGCAGAGTGGGTGAGG + Exonic
1127983384 15:64050437-64050459 GGCACAGGGCAGAGTGGGCATGG - Intronic
1128232842 15:66047717-66047739 GGCAGGAGGCCCAGTGGGCCTGG + Intronic
1128233299 15:66050322-66050344 GGAAAGGGGAAGAGGGGGCTGGG + Intronic
1128758015 15:70196393-70196415 GGCCAGGGGAGGAGGGGGCCGGG - Intergenic
1129245547 15:74276749-74276771 GGGAAGGGGCAGTGTGGGTGTGG - Intronic
1129831570 15:78674278-78674300 TGGAAGGGGCAGAGTGGTGCTGG + Intronic
1130384805 15:83401750-83401772 GGAGAGGGGCAGAGAGAGCCAGG + Intergenic
1130403945 15:83581402-83581424 TGGAAGGGGCAGCTTGGGCCTGG + Intronic
1130770595 15:86919907-86919929 GGCCCATGGCAGAGTGGGCCAGG - Intronic
1131439824 15:92451256-92451278 GGCAATGAGCTGAGTGGGCCAGG + Intronic
1132115261 15:99131277-99131299 AGAGAGGGGCAGGGTGGGCCGGG + Exonic
1132288727 15:100684801-100684823 GGCGCGGGTCACAGTGGGCCTGG + Intergenic
1202971105 15_KI270727v1_random:240370-240392 GGCAGGGGGCAGGGTGGGTTGGG - Intergenic
1132461829 16:59227-59249 GGCAAGTGACACTGTGGGCCGGG - Exonic
1132514937 16:361857-361879 GGCAGGGCACAGAGTGGCCCCGG - Intergenic
1132523180 16:400881-400903 GGGAAGGGGCAGAGAGGGGCCGG + Intronic
1132615490 16:839470-839492 GGGCAGGGCCAGAGTGGGGCCGG - Intergenic
1132639583 16:971467-971489 AGCAAGGGACAGAGTAGGCAGGG + Intronic
1133301117 16:4783589-4783611 GGCAGAGGGCAGAGTGGGCAGGG - Intronic
1133671557 16:8026919-8026941 GGCAGGGGTCAGGGTGGGGCGGG - Intergenic
1133768750 16:8855527-8855549 GGGAAGGAGCTGATTGGGCCAGG - Intronic
1134084523 16:11347206-11347228 TGCAAGGTGCTGAGTGGCCCGGG + Intronic
1134101606 16:11456467-11456489 AGCAAGGGGGAGAGTGGGGTGGG + Intronic
1134232125 16:12437533-12437555 ATCAAGGGGCAGAATGGGGCTGG + Intronic
1134245220 16:12534713-12534735 GGCAAGGGGCAGTGAGTGACAGG - Intronic
1135223898 16:20638898-20638920 GACAAGGAGGAGGGTGGGCCAGG - Intronic
1135294122 16:21264515-21264537 GGCATGGGGCAGGGTGGAACTGG + Intronic
1135530031 16:23245357-23245379 GGCAAGGGAGAGAGTGGAGCTGG - Intergenic
1135738959 16:24957069-24957091 AGCATGGAGCAGAGTGGGCCAGG + Intronic
1136080417 16:27848898-27848920 AGCAAGGGGTAGGATGGGCCTGG + Intronic
1136185466 16:28585878-28585900 GGTAACTGGAAGAGTGGGCCTGG - Intronic
1136234067 16:28903789-28903811 CGCAAGGGGCTGAGGGGGCGCGG - Intronic
1136775382 16:32868974-32868996 GGCAAGGGTCACACAGGGCCTGG - Intergenic
1136895234 16:33992538-33992560 GGCAAGGGTCACACAGGGCCTGG + Intergenic
1137770251 16:51010622-51010644 TGGAAGGGGCAGTGAGGGCCAGG + Intergenic
1138131631 16:54484809-54484831 GCCAAGGCGCAGATTGAGCCTGG + Intergenic
1138179344 16:54931471-54931493 GGCGAGGGGCAGCAGGGGCCGGG + Intronic
1138453513 16:57107437-57107459 GGCCAGGGTGAGAGTGGGGCTGG - Intronic
1139490599 16:67284022-67284044 GGGACGGGGCAGAGTGGAGCTGG + Intronic
1139513437 16:67440104-67440126 GGAAGGTGGCAGAGAGGGCCGGG - Intronic
1139706592 16:68745117-68745139 GGCAAGGCGCAGCTAGGGCCGGG + Intronic
1140700318 16:77575303-77575325 GGCCAGGGCCAGAGAGGGGCAGG + Intergenic
1140985738 16:80156648-80156670 GGCAAGACTCAGAGTGGGCAGGG + Intergenic
1141092190 16:81137849-81137871 GGGAAGGAGCAGGGTGGGGCAGG - Intergenic
1141425613 16:83942634-83942656 AGAAAGGTGCAGAGTGGACCAGG + Intronic
1141804642 16:86334691-86334713 GGCCTGGGTCAGAGGGGGCCTGG + Intergenic
1141915973 16:87097290-87097312 AGCAAAAGGCAGAGTGGGGCTGG - Intronic
1142003091 16:87675245-87675267 GGCAAGGGGAAGAGAGCTCCAGG - Intronic
1142235911 16:88922446-88922468 GGGAAGGGGCTGTATGGGCCTGG + Intronic
1142433755 16:90044393-90044415 GGCAGTGGGCAGACTGGTCCTGG - Exonic
1203077799 16_KI270728v1_random:1131083-1131105 GGCAAGGGTCACACAGGGCCTGG - Intergenic
1142555125 17:770007-770029 GGCAGGGGGCAGGCTGGACCAGG - Intronic
1142559598 17:802363-802385 GGCAAGGTTCAGAGTGGACGAGG - Intronic
1142688598 17:1591731-1591753 GGGAGGGGGCAGAGTTAGCCCGG + Intronic
1142712809 17:1732597-1732619 GGCGAGGACCAGGGTGGGCCAGG + Intronic
1143166152 17:4898130-4898152 AGAAAGGGGCAGGGTGGGCTGGG + Exonic
1143184750 17:5003498-5003520 GGCAAGGGCTAGAGAGAGCCAGG - Intronic
1143297231 17:5880444-5880466 AGCAAAGGGCAGAGTGGCCTGGG + Intronic
1143384922 17:6523491-6523513 AGCAAGAGGCAGAGTGAGCTGGG - Intronic
1143496336 17:7314949-7314971 CGCAAGCGGCAGGGTGAGCCGGG - Exonic
1144668312 17:17116873-17116895 GGCAAGGGCCAGAGAGGCACAGG + Intronic
1144798213 17:17907005-17907027 GGCATGGGGCAGACACGGCCGGG - Intronic
1145835418 17:27951063-27951085 GGCAAAGGGGAGAGAGGGCTAGG - Intergenic
1146889022 17:36492956-36492978 GGAAAAGGGGAGAGTGGGGCTGG + Intronic
1147150774 17:38512418-38512440 GGAAAGGGCCAGAGTGGGGCTGG + Intergenic
1147155741 17:38543774-38543796 GGCATGCAGCAGAGTGGGCCTGG + Intronic
1147316549 17:39623588-39623610 GGCAGGTGGCGGAGTCGGCCAGG - Intergenic
1147493388 17:40892890-40892912 GGCAAGGGGGACACTGGGACAGG + Intergenic
1147600008 17:41739558-41739580 GGCAAGGGGCTGAGGTGGCTGGG + Intergenic
1147668286 17:42162498-42162520 GGCAAGGGGCAGGATGAGGCTGG - Intronic
1147782297 17:42952233-42952255 GACAAGGGGCAGAGGCGGCCAGG - Intronic
1147815125 17:43204231-43204253 AGAAAGTGGCAGAGTTGGCCAGG - Intronic
1148138653 17:45312263-45312285 GGTGAGAGGCAGAGTGTGCCTGG - Intronic
1148145520 17:45362166-45362188 GGCATGGGGCCAAGGGGGCCTGG + Intergenic
1148476915 17:47934833-47934855 GGCAAGGGGCAGAATGGAGGTGG - Intergenic
1148836927 17:50470257-50470279 GGCAAGGGGCAGAGAGGTTTGGG - Intronic
1148847561 17:50538236-50538258 GGCTAGGGGGAGAGAGTGCCTGG + Intronic
1148850788 17:50554119-50554141 GGGAAGGGGCAGGATGGGCAGGG + Intronic
1148885002 17:50766104-50766126 GGGAAGGGGCTGAGTTGGGCAGG - Intergenic
1149258315 17:54851989-54852011 TCCAAGGGACAGACTGGGCCAGG + Intergenic
1149313973 17:55421821-55421843 GGGTAGGGTCGGAGTGGGCCAGG + Exonic
1149569989 17:57665594-57665616 GGCAGGGGGCAGGGTGGGGTGGG - Intronic
1150576488 17:66435221-66435243 GGCATTGGACAGAGAGGGCCAGG - Intronic
1151225971 17:72648679-72648701 GGGAAGGGGCAGAGAGGGGGAGG + Intronic
1151558715 17:74859973-74859995 GGCGGGGGGCAGCGTGGGGCGGG - Intronic
1151668455 17:75558658-75558680 GGCAAGGGTCAGGCTGGGCTGGG - Intronic
1151756036 17:76075831-76075853 GGCGAGAGGCAGAGTGGGCTGGG - Intronic
1151758407 17:76087606-76087628 GGCAAGGAGGCGAGTGGGGCAGG + Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152076714 17:78164504-78164526 GGCAGGGGCCAGGGTGGGCATGG - Intronic
1152190345 17:78884133-78884155 GGCAGGAGGCAGAGGGAGCCTGG + Intronic
1152362739 17:79839931-79839953 GGCAGGGGGCGGAATGGGGCAGG + Intergenic
1152374681 17:79913080-79913102 GCCAAGGGGCAGGGTGGGCGTGG - Intergenic
1152761369 17:82108849-82108871 GGGCAGGGGCAGCGTGGGGCGGG + Intronic
1152798470 17:82320287-82320309 AGCAGGGGGCAGTGTGGACCAGG + Intergenic
1153339804 18:3961786-3961808 GGCAAGGGGAAGCATGGGCTTGG + Intronic
1153501965 18:5759051-5759073 GGGAAGGGGGAGAGTAGTCCTGG - Intergenic
1153613349 18:6910073-6910095 GCTGAGGGGCAGAGTGTGCCTGG - Intronic
1153998499 18:10463062-10463084 GACAAGGGGCAGAGGGAGGCAGG - Intronic
1154203333 18:12316035-12316057 GGCCTGGGGCAGACTGGGCCGGG - Intronic
1154422573 18:14247287-14247309 AGGGAGGGACAGAGTGGGCCAGG + Intergenic
1155168229 18:23248071-23248093 GACCCGGGCCAGAGTGGGCCTGG + Intronic
1155276460 18:24192654-24192676 GAGATGGGGCAGAGTGAGCCCGG + Intronic
1155546256 18:26919025-26919047 GGCAAGAGGGAGAGTGTGCAGGG + Intronic
1155940351 18:31796177-31796199 TCCCAGGGGCAGTGTGGGCCAGG + Intergenic
1156466776 18:37352851-37352873 ACCAAGGTGCAGAGTGGGACGGG + Intronic
1156994234 18:43447284-43447306 GGCAAGGGGCAGTGGGGCCAGGG - Intergenic
1157274717 18:46302442-46302464 GGGATGGGGCAGAGTGGGGCGGG - Intergenic
1157289762 18:46401052-46401074 AGCAAGGGGCACACTGTGCCTGG + Intronic
1157564180 18:48668584-48668606 GGCAAGGGGCATGGTGGAGCTGG - Intronic
1158051474 18:53225969-53225991 GGCATGGGGCAGAGTGGTGATGG + Intronic
1158557160 18:58484970-58484992 GGGTAGGGGCAGAGGGTGCCTGG + Intronic
1159955414 18:74515391-74515413 GGCACGGGGAGGAGCGGGCCTGG + Intronic
1160492782 18:79351894-79351916 GGGCAAGGGCAGAGTGGGCTTGG - Intronic
1160526745 18:79543046-79543068 GGCAAGGGACAGGGGTGGCCAGG + Intergenic
1160546060 18:79656841-79656863 AGCAAAGGGCAGAGTGGGATGGG + Intergenic
1160605227 18:80044990-80045012 AGCAAGGGGCAGTGTGGGGGCGG + Intronic
1160738741 19:676439-676461 GGCAGAGGCCAGAGTGGCCCTGG - Exonic
1160766785 19:812402-812424 GGCCACGGGCGGGGTGGGCCCGG + Intergenic
1160856318 19:1219426-1219448 GGCAGGGGCCAGGGTGGGGCGGG + Intronic
1160868966 19:1268416-1268438 GTGGAGGAGCAGAGTGGGCCTGG + Intronic
1160990393 19:1857995-1858017 AGCTAGGGGCAGAGTGGGTGTGG - Intronic
1161016633 19:1986715-1986737 GGCAAGGCCCCGACTGGGCCAGG + Intronic
1161170582 19:2810577-2810599 AGCTCTGGGCAGAGTGGGCCGGG + Intronic
1161801237 19:6417709-6417731 GGCCAGGGGCAGGGTGGGCCAGG + Intronic
1162038460 19:7955200-7955222 GGCAAGGGGCAGGGAGAGCGCGG - Intergenic
1162452586 19:10763905-10763927 GGCAAGAGGCAATGGGGGCCTGG + Intronic
1162924299 19:13922325-13922347 AGCAAGGGGAAGAGTGAGCGAGG - Intronic
1162936548 19:13984265-13984287 GGCAAGGAGCAAAGAGGGCCAGG - Intronic
1163429150 19:17256567-17256589 TGCACGGGGCACAGTGGGCATGG + Exonic
1163537229 19:17883782-17883804 GGCAAGGGGCGGGGAGGGGCGGG + Intronic
1163611255 19:18302948-18302970 GGGAAGGGGCAGAGGGGGTCAGG - Intergenic
1163618378 19:18342797-18342819 GGCCAGGGGCAGACTGGGAAGGG + Intronic
1165346767 19:35253526-35253548 GGCATGGGGCAGAGCGGGGAAGG + Intronic
1165417926 19:35706280-35706302 GGCATGGGAAAGAGTGGGACAGG - Intronic
1165865205 19:38932702-38932724 GGCTGGGGGCACAGTGGGCTGGG + Exonic
1166111462 19:40625820-40625842 AGCATGTGTCAGAGTGGGCCTGG - Intronic
1166132967 19:40757617-40757639 GGCAAGGTGCAGTGGGAGCCTGG - Intronic
1166316412 19:41992207-41992229 GGCCAGGGCCAGGGTGAGCCAGG - Intronic
1166316572 19:41993004-41993026 GGGGTGGGGCAGGGTGGGCCGGG - Intronic
1166357313 19:42234765-42234787 GGCAGCAGGGAGAGTGGGCCTGG - Intronic
1166760938 19:45224225-45224247 GGGAAGGGGCTGATTGTGCCGGG + Intronic
1166875679 19:45895827-45895849 TGCAAGAGGCAGTGTGAGCCTGG - Intronic
1166997689 19:46727584-46727606 AGGGAGGGGCAGAGAGGGCCAGG + Intronic
1167422318 19:49411621-49411643 GTCAAGGGGAAGACTGAGCCAGG + Intronic
1167449122 19:49556738-49556760 TGCAAGGGGCAGAGAGAGGCGGG + Intronic
1167692095 19:50991955-50991977 TGCAAAGGGCACAGGGGGCCTGG - Intergenic
1168406683 19:56114279-56114301 GGCAAGTGGAGGAGTGGGGCCGG - Intronic
1168520325 19:57045001-57045023 AGGAAGGGGCAGAGAGAGCCGGG + Intergenic
1168598181 19:57695911-57695933 GGACAGGGGCTGAGTGGGCTGGG - Intronic
1202639997 1_KI270706v1_random:73848-73870 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
925165701 2:1714340-1714362 GGCATGGGAGCGAGTGGGCCAGG - Intronic
925384601 2:3453371-3453393 GCCGAGGGGCAGAAAGGGCCGGG - Intronic
925417203 2:3678715-3678737 AGGAAGGGGCAGCGTGAGCCCGG + Intronic
925873339 2:8289852-8289874 GCCAAGGAGCAGAGTGGGAGTGG - Intergenic
926153134 2:10435574-10435596 GGCGAGGGTCAGTCTGGGCCTGG - Intergenic
926196285 2:10765485-10765507 GCCAAGGGTCAGAGTGGAGCTGG + Intronic
926212074 2:10878659-10878681 GGCAAGGGGCTGGGGAGGCCTGG + Intergenic
926664709 2:15508706-15508728 AGCAAGGTGCAGACTTGGCCGGG + Intronic
927442682 2:23130363-23130385 GGCATGGGGCAAAGTGTGCTCGG + Intergenic
927782651 2:25951994-25952016 GCCAAGAGGCAGAGGGGGCTGGG + Intronic
927928491 2:27028919-27028941 AGAAAGGGTCAGAGTGGGCAGGG + Intergenic
929009144 2:37423975-37423997 GCCTAGGGGCAGAGTGGGGCAGG + Intergenic
929127598 2:38535617-38535639 GGCAGGGGGCAGAGTGTTCACGG - Intergenic
929551376 2:42895302-42895324 GGCCAGGGGCAGTGTGGGAGGGG - Intergenic
929766526 2:44848336-44848358 GGGAAAGAGCAGAGTGAGCCTGG + Intergenic
931429425 2:62196759-62196781 GGCAAGGGGCATCTGGGGCCGGG + Intronic
931694191 2:64859764-64859786 GGCAGGGGGCAGAGGTGTCCCGG + Intergenic
932352450 2:71043570-71043592 AGCCAGGGGCAGAGAGGGGCTGG - Intergenic
932565215 2:72901866-72901888 GGCAGGGGGCAGAGTGAGTGTGG - Intergenic
932702206 2:73999807-73999829 GGCTGGAGGCAGAGTGGCCCTGG + Intronic
933438770 2:82282820-82282842 GGATGGGGGCACAGTGGGCCAGG + Intergenic
933661589 2:84931836-84931858 GTCAAGAGGCAGAGTGAGCCAGG - Intergenic
934495489 2:94793299-94793321 AGGGAGGGACAGAGTGGGCCAGG - Intergenic
934775371 2:96933809-96933831 GGCAAGGGGGCAAGAGGGCCAGG + Intronic
935498882 2:103813946-103813968 GGCAAGGGGAAGAGAGTGGCTGG + Intergenic
936038542 2:109130585-109130607 GGCAGAAGGCAGAGTGGGACTGG + Intronic
936792129 2:116163281-116163303 GGCTAGGGGTAGAGGAGGCCTGG + Intergenic
936935831 2:117837171-117837193 GCAAAGGGGCAGCGTGGGGCTGG + Intergenic
937123098 2:119454231-119454253 GGCAGGCGGCAGAGTGGGGCTGG + Intronic
937263578 2:120601815-120601837 GGAGAGGGTCAGAGTGTGCCTGG + Intergenic
937337906 2:121072965-121072987 GGCAATGGGCAGTGGGAGCCAGG - Intergenic
937419245 2:121740810-121740832 GGGAAGGAGGAGAGGGGGCCTGG - Intronic
937449430 2:121989602-121989624 GGAAAGGATCAGAGAGGGCCTGG - Intergenic
937913759 2:127088977-127088999 GGCAGGGGGCAGGGAGGACCAGG + Intronic
937988308 2:127648553-127648575 GGCACGGGGCAGAGAGGGCATGG - Intronic
938199627 2:129362264-129362286 GGCCAGCGGCAGAGACGGCCAGG - Intergenic
938651715 2:133390170-133390192 GGCATGGACCACAGTGGGCCTGG - Intronic
939984176 2:148814014-148814036 GGCAGGAGGAAGAGGGGGCCAGG - Intergenic
941367029 2:164621567-164621589 GGCAAGGCGCGGAGGGGGCGGGG + Exonic
942748714 2:179264605-179264627 GGCTGGGGGCGGAGCGGGCCCGG + Exonic
943557798 2:189427148-189427170 TGCATGGGGCAGAGGGGCCCTGG - Intergenic
946100402 2:217315623-217315645 GGTAGGGGGCACAGTGGGCCAGG - Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946396391 2:219445690-219445712 GGCCAGGGGCAGATGGGGCAAGG + Intronic
946427214 2:219605769-219605791 GGGAAGGGGGAGAGTGAGGCTGG + Intronic
946961851 2:224993712-224993734 GGTAGGGGACAGAGTGGGCTTGG - Intronic
948201376 2:236131943-236131965 GGCCTGGGGCAGCCTGGGCCTGG - Intergenic
948356869 2:237385003-237385025 AGCAGGGGGAAGAGTGGTCCAGG - Intronic
948565739 2:238884936-238884958 GGTAAGGGGCAGAGCAGGCCAGG + Intronic
948610281 2:239162329-239162351 AGCCAGGGGCAGGGTGGGCCTGG - Intronic
948634724 2:239327832-239327854 TGCAGGGAGCAGTGTGGGCCAGG - Intronic
1168805604 20:670639-670661 GGCAAAGGGCAGCGGGGGGCAGG - Intronic
1168811134 20:705359-705381 CAAAAGGGGCACAGTGGGCCAGG - Intergenic
1168965179 20:1894537-1894559 GGGGAGGGGCAGAGCGGGACCGG + Intronic
1169120955 20:3095287-3095309 GGCCAGGGGCAGGCTGGGGCAGG - Intergenic
1169141760 20:3230653-3230675 GGCAGGGGGCAGGGCGGGTCAGG + Intronic
1169195598 20:3680736-3680758 GGGAAGAGGTAGGGTGGGCCCGG + Intronic
1170097226 20:12659502-12659524 GGTAAGGGGAAGAGTGGTTCAGG - Intergenic
1170156552 20:13274431-13274453 GGGAAGGGGCAGATGAGGCCAGG - Intronic
1170890068 20:20368821-20368843 GGCAGGGGGCAGTGGGGGGCCGG - Exonic
1171784415 20:29449149-29449171 GGCCAGGGCCAGGCTGGGCCAGG + Intergenic
1171886888 20:30660498-30660520 GGGGAGGAACAGAGTGGGCCAGG - Intergenic
1172010634 20:31844067-31844089 GGCAAGGGAGAGACTGGGCAGGG - Intergenic
1172106241 20:32518777-32518799 GGCAGGGTGGAGAGTGGGGCAGG + Intronic
1172245684 20:33443696-33443718 GGCAGAGGGCAGCGGGGGCCCGG + Exonic
1172250466 20:33475840-33475862 GCCAGGGTGCAGAGAGGGCCAGG + Intergenic
1172621411 20:36320420-36320442 GGCAAGGGTCAGTGTGGGCCTGG - Intronic
1172778186 20:37420194-37420216 GGCAGGGGCCAGACGGGGCCTGG - Intergenic
1172778209 20:37420332-37420354 GGCATGGGGGAAAGAGGGCCGGG - Intergenic
1172845458 20:37927623-37927645 GGCAAGGCTCAGAGAGGGCAGGG - Intronic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173725982 20:45298139-45298161 GGCATGGGACACAGTGGGCTGGG - Intronic
1173822415 20:46028276-46028298 GGCCAGGGACAGAGTGGGGGAGG - Intronic
1173855912 20:46250858-46250880 GGCATGGGGCGGAGTGGGAGTGG + Intronic
1173872314 20:46349889-46349911 GGGAGGGGACAGTGTGGGCCTGG - Exonic
1174056239 20:47800344-47800366 GGCCAGGCTCAGAGAGGGCCAGG - Intergenic
1175213300 20:57375366-57375388 GGCAAAGGGCAGAGTGGGGTGGG - Intronic
1175835205 20:61989307-61989329 GGGAAGCTGCAGAGTGGGCAGGG + Intronic
1175891866 20:62319278-62319300 GCCAGGGAGCAGGGTGGGCCAGG - Intronic
1176000978 20:62830974-62830996 GGCAGGAGGCAGAGCGGCCCAGG - Intronic
1176110831 20:63409972-63409994 GGGAGGGGGGAGGGTGGGCCAGG + Intronic
1176130583 20:63495143-63495165 GGCAGGGGACAGAGCGAGCCTGG + Intronic
1176144801 20:63560767-63560789 GGCTGGGGGCTGAGTGGGGCGGG + Intronic
1176195768 20:63835870-63835892 GGCAAGGGGCAGGGAGAGCGCGG + Intergenic
1176293988 21:5060874-5060896 CGCAGGAGGCAGAGCGGGCCTGG + Intergenic
1176307294 21:5130418-5130440 GGCGAGGGACAGGCTGGGCCTGG + Intergenic
1176597286 21:8759045-8759067 GGAAAATGGCGGAGTGGGCCGGG - Intergenic
1176643103 21:9325007-9325029 GGAAAATGGCGGAGTGGGCCGGG - Intergenic
1176648330 21:9371440-9371462 GGGGAGGGACAGAGTGAGCCAGG - Intergenic
1176850891 21:13912671-13912693 AGGGAGGGACAGAGTGGGCCAGG - Intergenic
1178427582 21:32491391-32491413 TAGAAGGGGCACAGTGGGCCGGG + Intronic
1178840276 21:36132982-36133004 AGCAAGGGCCAGGGTGGGGCTGG + Intergenic
1179455528 21:41497128-41497150 GACAAGGGGCAGGCTGGGCGTGG - Intronic
1179810013 21:43864767-43864789 GGTCGGGGGCAGAGGGGGCCGGG - Intergenic
1179849765 21:44131612-44131634 GGCGAGGGACAGGCTGGGCCTGG - Intergenic
1179863271 21:44202774-44202796 CGCAGGAGGCAGAGCGGGCCTGG - Intergenic
1179884197 21:44306496-44306518 GGCAAGGGTCAGGGAAGGCCCGG - Intronic
1179911977 21:44455477-44455499 GGCGAGGGGCGGGGTGGGGCGGG - Exonic
1179982935 21:44905854-44905876 GCCTTGGGGCAGAGTGGCCCAGG - Intronic
1180163051 21:46006631-46006653 GGGATGGGGAAGAGCGGGCCTGG - Intergenic
1180361943 22:11908051-11908073 AGGGAGGGACAGAGTGGGCCAGG + Intergenic
1180369830 22:11974209-11974231 GGAAAATGGCGGAGTGGGCCGGG + Intergenic
1180421162 22:12815789-12815811 GGAAAATGGCGGAGTGGGCCGGG + Intergenic
1180742757 22:18065208-18065230 GAGAGAGGGCAGAGTGGGCCAGG + Intergenic
1180907683 22:19426331-19426353 GGCAAGAGGGAGAATGGGGCTGG - Intronic
1181172080 22:21015449-21015471 GGAAGGGGGCAGATTGGGACGGG + Intronic
1181625743 22:24121057-24121079 GGCGAGGGCCAGAGAGGGCCAGG + Intronic
1181922957 22:26334792-26334814 GAGAAGGGCCAGAGTGGGCAGGG + Intronic
1182149887 22:28020466-28020488 GCCAAGGGGCAGAGGGGTCAGGG + Intronic
1182354078 22:29714348-29714370 GGGAAGGGGCAGGGTTGGGCTGG + Intergenic
1182441749 22:30368680-30368702 GGCCTTGGGCAGAGAGGGCCTGG - Intronic
1183378148 22:37476997-37477019 GCCAAGGGGCAGAGTGAGCCTGG + Intronic
1183668781 22:39260015-39260037 GGAAAGGAGCAGAGGGGACCTGG - Intergenic
1183698636 22:39437542-39437564 GGAAAGGAGCAGAGTGGGAGGGG - Intergenic
1183741981 22:39673923-39673945 GGCCTGGGGCTGAGTGGGCAGGG + Intronic
1183953404 22:41365223-41365245 GGTAAGGGTGAGAGTGAGCCTGG - Intergenic
1183972825 22:41491115-41491137 GGCAAAGGGCAGACTGGGAATGG + Intronic
1184109042 22:42384485-42384507 GGCATGGAGCAGAGAGGGCTTGG - Exonic
1184161949 22:42702216-42702238 GGCAGGAGACAGAGAGGGCCAGG + Intronic
1184400778 22:44272726-44272748 GACAAGGGGCAAGGTGGTCCTGG - Intronic
1184660004 22:45961345-45961367 GGCAAGTGGCAGGGGAGGCCCGG + Intronic
1184679201 22:46061403-46061425 GGGAAGGGGCCGACTCGGCCAGG + Intronic
1184816750 22:46877976-46877998 GGCCAGAGGCAGAGGGGTCCTGG - Intronic
1185096088 22:48806807-48806829 GCCATGGGGCACAGTGGTCCTGG + Intronic
1185211579 22:49573541-49573563 AGCAAGGCCCAGAGTGGGCAGGG + Intronic
1185234670 22:49704969-49704991 GGCAACAGGCAGCGTGGGTCTGG + Intergenic
1185379662 22:50502626-50502648 CGGAAGGGCCAGAGTGGGCAAGG - Intergenic
1185423102 22:50746151-50746173 AGCATGGGGCAGTGTGGGGCAGG - Intergenic
949318749 3:2785882-2785904 GGGGGGGGGCAGCGTGGGCCAGG - Intronic
949898655 3:8791930-8791952 GCCAAGGGGCAGAGTGAGGGAGG - Intronic
950067104 3:10121325-10121347 GGAAAGTGGCAGAGTTGGGCTGG + Intronic
950203842 3:11062915-11062937 GCCAAGGGGGTCAGTGGGCCTGG + Intergenic
950563422 3:13749186-13749208 GGCCTGAGGCAGAGTGAGCCAGG - Intergenic
952450365 3:33426595-33426617 TGCCAGGGGCTGAGTGGGTCTGG - Intronic
953552085 3:43910967-43910989 GGCAAGAGGAAGAGTGGGGGAGG - Intergenic
953827005 3:46262048-46262070 GACATGGGGCAGAGTGGGAAGGG - Intronic
953947946 3:47164660-47164682 GGCAAGGGAGAGAGAGGGCGAGG - Intergenic
954106719 3:48413592-48413614 GGGAAGGGACAGACCGGGCCAGG - Intronic
954160627 3:48719049-48719071 TGCTGGGGGCAGAGTGGGGCAGG - Intronic
954258688 3:49423464-49423486 GGAAAGGGGCAGGGCGGGCGCGG + Exonic
954611809 3:51948277-51948299 AGCAAGGGCCAGGGTGGCCCAGG - Intronic
954714573 3:52520705-52520727 GGCTAGGGGCTGAGTGGGGGTGG + Intronic
954873673 3:53786718-53786740 GGGCAGGGGCAGAGTGGGGCGGG - Intronic
955721528 3:61886546-61886568 GGCAAGGGGCAGGGCGGGGAAGG - Intronic
955829595 3:62986927-62986949 GGGCTGGGGCAGAGTGGGCTAGG - Intergenic
961673175 3:128549440-128549462 GGCTGGGGGCAGGGTGGGCCTGG + Intergenic
962698342 3:137972777-137972799 TCCAGGGGGCAGAGTGGACCAGG - Intergenic
964624263 3:158744227-158744249 AGCAAGGGGCAGACTGGTCTGGG + Intronic
968185644 3:196632313-196632335 GGCCGGGGGCAGGGTGGGGCTGG - Intergenic
1202738554 3_GL000221v1_random:33544-33566 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1202743781 3_GL000221v1_random:80022-80044 GGAAAATGGCGGAGTGGGCCGGG + Intergenic
968646061 4:1741183-1741205 GGCAGGAGGCAGAGTGAGCAGGG + Intronic
968737520 4:2305015-2305037 GAGAAAGGGCAGGGTGGGCCAGG - Exonic
968830062 4:2928702-2928724 GACAAGGGGCAGGGTGGGGTGGG - Exonic
968866044 4:3212585-3212607 GGCCCGGGCCAGAGTGGGCAGGG - Exonic
968943585 4:3652101-3652123 CACAAGGGGCAAGGTGGGCCAGG - Intergenic
969333838 4:6495200-6495222 TGCGAGTGGCAGAGTGGACCAGG - Intronic
969436335 4:7191631-7191653 GGCCATGGGCAGGGTGGCCCTGG + Intergenic
970204043 4:13638312-13638334 GGCAAGAGGCAGAGTGGTAGTGG + Intergenic
971531358 4:27693036-27693058 GGCATTGAGCAGAGAGGGCCTGG + Intergenic
973360577 4:49161264-49161286 GGAAAATGGCGGAGTGGGCCGGG - Intergenic
973370244 4:49240191-49240213 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
973390785 4:49555229-49555251 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
982740782 4:159054811-159054833 GGCAAGGGGCAGGGTGGGAGGGG - Intergenic
985053703 4:186017892-186017914 GGCAGGAGGCAGAGTGAGCAGGG + Intergenic
1202767357 4_GL000008v2_random:159707-159729 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
985651274 5:1108891-1108913 GGCCAGGGGCAGAGGGAGGCAGG + Intronic
985668885 5:1196289-1196311 GGCAATGGGCAGGGCTGGCCAGG + Intergenic
985722551 5:1497423-1497445 GGCAAGAGGCAGAGTGGAGCCGG + Intronic
986165322 5:5267709-5267731 GGATGGGGGCATAGTGGGCCAGG + Intronic
986240030 5:5952455-5952477 TGCATGAGTCAGAGTGGGCCAGG + Intergenic
987962152 5:24824206-24824228 GGCATGGAGCAGAGAGAGCCTGG + Intergenic
988453129 5:31363150-31363172 GGAAAAGGGAAGAGAGGGCCAGG + Intergenic
988491362 5:31708188-31708210 GGGAAGGGCCAGAAAGGGCCAGG - Intronic
989143815 5:38228520-38228542 GTCACTGGGCAGAGTGGGCCAGG - Intergenic
989173635 5:38498372-38498394 TGCAAGGTGAAAAGTGGGCCAGG - Intronic
991962218 5:72056511-72056533 GGCAGGGAGCAGAGTGGGACAGG + Intergenic
995324964 5:110880113-110880135 AGAAAGGGACACAGTGGGCCTGG - Intergenic
995476330 5:112552168-112552190 GGCTGGGGGAAGAGTGGTCCAGG + Intergenic
995834370 5:116385655-116385677 GGCAACGGACTTAGTGGGCCAGG - Intronic
997235751 5:132271161-132271183 GTCAGGGGTCAGAGTGGGACTGG - Intronic
997279303 5:132628935-132628957 GGCAATGGTTAGAGTGGACCAGG + Intronic
997385299 5:133467660-133467682 GGCAAGGGGGAGAGAAGGGCAGG + Intronic
998626028 5:143846892-143846914 GGCAAGGGGCAAACAGGGGCTGG + Intergenic
999300301 5:150486407-150486429 GGTAAGAGGCCGAGAGGGCCCGG + Intronic
999702569 5:154241315-154241337 GGAAAGGGGCAGAGAGGGGTGGG + Intronic
1001925451 5:175632964-175632986 CTCAAGGAGCAGAGTGGGCAAGG - Intergenic
1002535705 5:179874300-179874322 GGGAAAGGGCATGGTGGGCCTGG + Intronic
1002835210 6:860051-860073 GGGAAGGGGTAGAGGTGGCCAGG + Intergenic
1002872530 6:1179680-1179702 GGCAAGAGGCACAGTGTGGCTGG - Intergenic
1002876650 6:1216350-1216372 GGCCAGGGCCAGAGTGAGGCAGG - Intergenic
1003092843 6:3118663-3118685 GCTTCGGGGCAGAGTGGGCCGGG + Intronic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1004043874 6:12008928-12008950 GGCGTGGGGCAGAGTTGGCAGGG + Intronic
1004596731 6:17106062-17106084 AGCTAGGGACAGAATGGGCCTGG - Intronic
1006075295 6:31528865-31528887 GACGTGGGGCAGAGTGGGGCAGG + Exonic
1006336920 6:33425746-33425768 GGGGAGGGGCGGCGTGGGCCAGG + Intronic
1006379485 6:33689210-33689232 GGCCAGGGGCAGGGTGAGCAGGG - Intronic
1006547577 6:34792372-34792394 GGAGAGAGGCAGACTGGGCCCGG - Intronic
1006919362 6:37617252-37617274 GCCAAGAGGCAGAGTTGGGCAGG - Intergenic
1006924502 6:37647146-37647168 GCCAAGGGGGAGCGGGGGCCTGG - Intronic
1007110508 6:39310871-39310893 GGTAAGGGCCAGATGGGGCCAGG - Exonic
1007257187 6:40537566-40537588 GACAAGGGTCAGAGTGGTCAGGG - Intronic
1007261587 6:40567794-40567816 GTCAAGGGGCAGACCTGGCCTGG + Intronic
1007558019 6:42782809-42782831 AGCAGGGGGCAGGGAGGGCCTGG + Intronic
1007591205 6:43021790-43021812 GGCATGGGGCAGGGCGGGCTGGG + Intronic
1007727776 6:43927031-43927053 GGGAAGGGGGACAGAGGGCCCGG + Intergenic
1008032251 6:46709981-46710003 GGCAAGGGGAAGGGTGTGTCAGG + Intronic
1008796097 6:55304893-55304915 GGCAAGGGGCAGAATGGACAGGG - Intergenic
1012935413 6:105362855-105362877 AGCAAGGGGCAGAGGAGGCAGGG + Intronic
1014214486 6:118739263-118739285 GGCATGGGCCAGGCTGGGCCTGG - Intergenic
1014222869 6:118815887-118815909 GGTAAGGAGAAGAGTGAGCCAGG - Exonic
1014947441 6:127515465-127515487 GGGGATGGGAAGAGTGGGCCTGG - Intronic
1017019791 6:150130887-150130909 GGCAAGGGGTGGAGAGGGCAGGG + Intergenic
1017743737 6:157428624-157428646 GGCTAGGGGCGGGGTGGGGCGGG - Intronic
1018053219 6:160029727-160029749 GGCTTGGGGCAGGGTGGGCCTGG + Intronic
1018057516 6:160065161-160065183 GTCAGTGAGCAGAGTGGGCCAGG + Intronic
1018926308 6:168209320-168209342 GGCCAGGGGCTGAAGGGGCCTGG + Intergenic
1019322214 7:420920-420942 GGGACGGGGGAGAGTGGGCGGGG - Intergenic
1019515596 7:1438538-1438560 GGCAGGGTGCAGGGTGGGGCTGG - Intronic
1019648275 7:2142454-2142476 CACAAGGGGCAGAGGGGGACAGG + Intronic
1019698601 7:2461353-2461375 GGCAGGGGCCAGATTGGGACAGG - Intergenic
1019724665 7:2594807-2594829 GGCACAGGGCAGGGTGGGGCGGG - Intronic
1019738328 7:2661134-2661156 GTGAAGGGGCAGAGTAGCCCGGG + Intronic
1019751116 7:2730428-2730450 GGCATGGGGCAGGGTGGGAAGGG + Exonic
1020102357 7:5401335-5401357 GGCGAGGGGCAGAGGTGGGCCGG - Intronic
1020112578 7:5455873-5455895 CGCATGGGGCAGAGATGGCCAGG - Intronic
1020128595 7:5546874-5546896 GGCATTGGGCAGAGATGGCCAGG - Intronic
1020821286 7:12971510-12971532 GGAAAGTGGCAGAGCAGGCCAGG + Intergenic
1021673483 7:23057113-23057135 GGGAAGGTGGGGAGTGGGCCTGG + Intergenic
1021928303 7:25554241-25554263 GGGAAGGCACAGGGTGGGCCTGG - Intergenic
1023208092 7:37773156-37773178 GGCAGGGGGCAGAGTGGGAATGG - Intronic
1023500528 7:40844596-40844618 GGTTGGGGGCAGGGTGGGCCAGG + Intronic
1023834448 7:44060096-44060118 GGCCAGGGGCTCAGTGGGCAAGG + Exonic
1023872674 7:44271262-44271284 GGCAGGGTGCAGAGTGTGCCTGG - Intronic
1024042129 7:45564020-45564042 GGCAAGGGGCAGAGACGCACAGG + Intergenic
1024512156 7:50212807-50212829 AGCAGGGGACAGAGTGGGGCTGG + Intergenic
1024544855 7:50508617-50508639 GGCAAGGGGCACATTTGGCAGGG - Intronic
1024784435 7:52890774-52890796 GGGCAGGGGCACAGTGGGGCAGG + Intergenic
1025236759 7:57239811-57239833 GGCCAGGCTCAGAGAGGGCCAGG + Intergenic
1025941605 7:66079419-66079441 GGCATGGGACAGAGTGGGGAGGG - Intronic
1025983310 7:66425799-66425821 GGCAAGGGGGATAGTGGGGATGG + Intergenic
1027267173 7:76500818-76500840 CGCAAGGTGGAGAGTGGGGCAGG - Intronic
1027318985 7:77000686-77000708 CGCAAGGTGGAGAGTGGGGCAGG - Intergenic
1028837827 7:95394500-95394522 TGCATGGGGCAGAGTGGACGGGG + Intronic
1028896422 7:96046839-96046861 TGCAAGGGGAGGAGTGGGCTTGG + Intronic
1029599454 7:101555307-101555329 GGCAAGGGGCAGGGTAGGTGTGG - Intronic
1029736690 7:102469276-102469298 GACAGGGGACAGAGTGGCCCAGG - Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1030640760 7:112003625-112003647 GGCCTGGAGCAGAGTTGGCCTGG + Intronic
1031046878 7:116900526-116900548 GGTGGGGGTCAGAGTGGGCCAGG + Intronic
1031980765 7:128122928-128122950 ATCAAGGGGCAGAGGTGGCCTGG + Intergenic
1032074310 7:128829409-128829431 GACCAGGGGCAGAGTGGTCAGGG - Intergenic
1032281975 7:130511145-130511167 GGCAAAGGGCAGAGTGGGAAAGG + Intronic
1032482238 7:132256405-132256427 GGTCTGGGGCAGAGTGGGGCTGG + Intronic
1033262794 7:139858147-139858169 GCCATGGGGCAGAGTGAGCATGG - Intronic
1033707984 7:143906988-143907010 GTGAAGGGGAAAAGTGGGCCTGG - Intergenic
1034257235 7:149731326-149731348 GGAAAATGGCAGAGTGGGCTGGG + Intronic
1034396124 7:150826182-150826204 CGGAAGGGGCAGAGTGTTCCAGG + Intronic
1035023933 7:155814566-155814588 TGCAAGGGGCAGGGTGGGTGGGG + Intergenic
1035187577 7:157138671-157138693 GGCACGCGGCGGAGTGGGCGGGG - Intergenic
1035246423 7:157565399-157565421 GACAAGGTGCAGAGTGAGTCTGG - Intronic
1035510727 8:180075-180097 GGCAAACAGCAGAGTGGCCCTGG + Intergenic
1035572488 8:682030-682052 GCCAAGGGGCAGGGTGGGGGTGG - Intronic
1035606028 8:930183-930205 GGCAAGGGGCTGCGTAGCCCTGG - Intergenic
1035742206 8:1936969-1936991 GGCAAGGTGCAGATGGGACCTGG + Intronic
1037883649 8:22585289-22585311 GGAAAGGGACAGTGTGTGCCAGG - Intronic
1037913999 8:22761067-22761089 GGCCATGGGCAGAGGGGGCCAGG - Intronic
1038544030 8:28412030-28412052 GGCAAGGGGCCGGGAGGGCGCGG + Intronic
1038735409 8:30164546-30164568 AGCAAGGAGCAGAGTAGCCCAGG - Intronic
1038949863 8:32402489-32402511 CGCATGGGACAGAGTGGGACAGG - Intronic
1040101182 8:43507360-43507382 GGGGAGGGACAGAGTAGGCCAGG + Intergenic
1041526817 8:58815619-58815641 GGTACAGGGCCGAGTGGGCCTGG + Exonic
1042847027 8:73178668-73178690 GGACAGGGGTAGAGTGGGGCTGG - Intergenic
1042957862 8:74271253-74271275 AACAAGGGGGAGGGTGGGCCTGG - Intronic
1043487720 8:80714803-80714825 GGCAAGAGGCAGGTAGGGCCAGG + Intronic
1043493989 8:80780158-80780180 GGCAAGTGGCACAGTGTGGCTGG + Intronic
1043907881 8:85828744-85828766 GGCATGGGTCAGAGTGGGTGGGG + Intergenic
1046832759 8:118764337-118764359 GGCAGTGGACACAGTGGGCCTGG - Intergenic
1047437515 8:124847211-124847233 GGCAAGGGCCTGAGTGGGTCAGG + Intergenic
1048810801 8:138284312-138284334 GCCACTGGGCAGAGTGGTCCAGG - Intronic
1048826291 8:138430654-138430676 GCCAGGTGGCAGAGTTGGCCTGG + Intronic
1049184867 8:141244847-141244869 CGCACAGGGCTGAGTGGGCCTGG - Intronic
1049186614 8:141258273-141258295 GGCACGGAGCAGAGTGAGGCTGG - Intronic
1049228678 8:141470766-141470788 GGCCAGGGGCAGGGTGGGTGAGG + Intergenic
1049255862 8:141613465-141613487 GGCCATGGGGAGAGTGGGCTGGG + Intergenic
1049398370 8:142412462-142412484 GGCGAGGGGCAGTGTGGGCTGGG - Intergenic
1049398377 8:142412483-142412505 GGCAAGGGGCAGTGTGGGCTGGG - Intergenic
1049405397 8:142449946-142449968 GGCGAGGCCCAGAGCGGGCCGGG + Exonic
1049441617 8:142612315-142612337 GGCATTGGGGAGAGTGGGCCGGG - Intronic
1049642488 8:143721886-143721908 GGACGGGGGCAGACTGGGCCGGG - Intronic
1049672670 8:143876845-143876867 GGGGAGGGGCAGTGCGGGCCAGG + Intronic
1049674074 8:143882117-143882139 GGGGTGGGGCAGAGAGGGCCTGG - Intergenic
1049684553 8:143934108-143934130 GGGAAGGGGCCGCGTTGGCCGGG + Intronic
1050845323 9:10209496-10209518 AGCAAGGGGCAGTGGGGGGCTGG - Intronic
1051406850 9:16746679-16746701 GGCCAGGGGCAGTGTGGCTCAGG + Intronic
1052876447 9:33570298-33570320 GGGGAGGGACAGAGTGGGCCAGG + Intronic
1053066439 9:35072413-35072435 GGCAAGCGACCGACTGGGCCGGG + Exonic
1053073740 9:35115932-35115954 GACAAGGGAGAGGGTGGGCCCGG - Intronic
1053128952 9:35604861-35604883 GGAAATGGGCAGGCTGGGCCGGG + Intergenic
1053499560 9:38574046-38574068 GGGGAGGGACAGAGTGGGCCAGG - Intronic
1053661644 9:40287071-40287093 AGGGAGGGACAGAGTGGGCCAGG + Intronic
1053912014 9:42916421-42916443 AGTGAGGGACAGAGTGGGCCAGG + Intergenic
1054373765 9:64433304-64433326 AGGGAGGGACAGAGTGGGCCAGG + Intergenic
1054522964 9:66089213-66089235 AGGGAGGGACAGAGTGGGCCAGG - Intergenic
1054821186 9:69521868-69521890 GGAAAGGGGCTGAGTTGGGCAGG + Intronic
1054878311 9:70119796-70119818 GGCAATGGGCAGGGTGGGGATGG + Intronic
1054883057 9:70165243-70165265 GGCAAGCGGATGAGTGGGCCTGG - Intronic
1055781857 9:79829241-79829263 GAGAAGGAGCAGAGTGGCCCTGG - Intergenic
1055964366 9:81851002-81851024 GGAATGGGGCAGAGAGGGCTGGG + Intergenic
1056119499 9:83473217-83473239 GGGAAGAGGCAAGGTGGGCCAGG - Intronic
1056199225 9:84258341-84258363 GGGAAGGGGCAGAACTGGCCAGG + Intergenic
1056587159 9:87936173-87936195 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1057214846 9:93222151-93222173 GGGAAGGGGCAGAGGGAGCAGGG - Intronic
1057317229 9:93977454-93977476 AGGAAGGAGGAGAGTGGGCCTGG - Intergenic
1057678986 9:97158747-97158769 GGGGAGGCACAGAGTGGGCCAGG - Intergenic
1057742304 9:97722472-97722494 ATCAAGGGGCAGGGAGGGCCAGG - Intergenic
1057858879 9:98624255-98624277 GGCAAGCAGCAGACAGGGCCAGG + Intronic
1058674514 9:107389037-107389059 GGCAAGGTGCACAGTGGAGCTGG - Intergenic
1059391318 9:114001268-114001290 GGCAAGGGGCTGGGGGGGCCAGG + Intronic
1060358278 9:122931267-122931289 GGCGGGGCGCAGCGTGGGCCGGG + Intronic
1060723646 9:125994084-125994106 GGCAGGGGTCAGAGTGCTCCAGG - Intergenic
1060839823 9:126784585-126784607 GGGAGGGGGAAAAGTGGGCCGGG - Intergenic
1061512239 9:131068343-131068365 GGCAAAGGGCACAATGTGCCTGG - Intronic
1061539722 9:131271640-131271662 GCCAAAGGGCAGACTGGGCGGGG - Intronic
1061580068 9:131531045-131531067 GGTAAGGGGCCGAGCGGGCCGGG - Intronic
1061614925 9:131773330-131773352 GTCAAGAGGCAGAGGGAGCCAGG - Intergenic
1061616749 9:131785318-131785340 GACAGGGGGCAGAGGGGGCAGGG + Intergenic
1061646729 9:132009017-132009039 GGCCACGGGCAGAGTGGGGAGGG - Intronic
1061702827 9:132428874-132428896 GCCAATGGTCAGAGAGGGCCTGG - Intronic
1061756966 9:132821268-132821290 GGGAAGGGACAGAGTGAGCGTGG - Intronic
1061873585 9:133533241-133533263 CCCAGGGGGCAGTGTGGGCCTGG + Intronic
1061886949 9:133595958-133595980 GGCAAGGGTCAGAAGGGGGCTGG + Intergenic
1062074151 9:134575419-134575441 GGCAGGAGACAGAGAGGGCCAGG - Intergenic
1062091192 9:134679572-134679594 GGCTAGGGGCACTGTGGGGCTGG + Intronic
1062138425 9:134942168-134942190 TCCAAGGGGCAGAGCGGGGCAGG - Intergenic
1062331932 9:136048754-136048776 GGTTGGGGGCAGAGGGGGCCAGG - Intronic
1062421366 9:136484120-136484142 GGCTGGGGCCAGGGTGGGCCTGG - Exonic
1062447303 9:136600312-136600334 GGCTGGGGGCAGGGAGGGCCGGG + Intergenic
1062461971 9:136665970-136665992 GGCCGGGGGCGGAGCGGGCCGGG + Intronic
1062489171 9:136796218-136796240 GGCTGGGGGCAGAGTGAGGCAGG + Intronic
1062636142 9:137492736-137492758 GGCTATGGGCTGGGTGGGCCGGG + Intronic
1062696705 9:137879374-137879396 GGCACAGGGCAGACTGGCCCAGG - Intronic
1203689616 Un_GL000214v1:30349-30371 GGAAAATGGCGGAGTGGGCCGGG - Intergenic
1203707286 Un_KI270742v1:63991-64013 GGGGAGGGACAGAGTGGGCCAGG + Intergenic
1203712415 Un_KI270742v1:109986-110008 GGAAAATGGCGGAGTGGGCCGGG + Intergenic
1203548111 Un_KI270743v1:144579-144601 GGGGAGGGACAGAGTGGGCCAGG - Intergenic
1203556015 Un_KI270743v1:208312-208334 GGAAAATGGCGGAGTGGGCCGGG + Intergenic
1203646659 Un_KI270751v1:73704-73726 GGAAAATGGCGGAGTGGGCCGGG + Intergenic
1185595975 X:1307294-1307316 GTAAAGGAGAAGAGTGGGCCTGG - Intronic
1190120518 X:47655675-47655697 GGCAAGAGGAATAGTGTGCCTGG - Intronic
1190221489 X:48515097-48515119 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190232137 X:48590460-48590482 GGGCAGGAGCAGAGTGAGCCAGG + Intronic
1190248597 X:48706432-48706454 GGCAAGGGGTCGAGAGGGGCAGG + Intronic
1190737055 X:53262561-53262583 TGGAAGGAGCAGACTGGGCCAGG + Intronic
1190764965 X:53468428-53468450 TGCCAGGGGCTGAGTGGGGCCGG - Intergenic
1193141877 X:78036231-78036253 GGCAAGGGGCATAGGGGTGCTGG + Intronic
1193527534 X:82612050-82612072 TGCAAAGGGCAGAGGGGCCCTGG - Intergenic
1193555705 X:82951433-82951455 AGCATGTGGCAAAGTGGGCCAGG + Intergenic
1196021503 X:110995756-110995778 GGCAAGGGGAAGAGTGTAACAGG - Intronic
1197507639 X:127327488-127327510 GGCAAGGGGGAGTGTGTGCAGGG + Intergenic
1197734006 X:129836578-129836600 TGAAAGGGGCAGTGTGGGCTGGG - Intronic
1197889742 X:131257449-131257471 TGTAAGGGGCAGACTGAGCCAGG + Intergenic
1200104536 X:153705083-153705105 GGCAAGGGTCACACAGGGCCTGG + Intronic
1200161534 X:154012338-154012360 GGCGAGGGAAGGAGTGGGCCAGG + Intronic
1200231443 X:154445750-154445772 GGCCAGCGGAAGAGTGGCCCGGG - Intronic
1200254067 X:154569969-154569991 GGGAAAGGGCAGAGTTGGCAGGG - Intergenic
1200263702 X:154634439-154634461 GGGAAAGGGCAGAGTTGGCAGGG + Intergenic
1200292456 X:154886238-154886260 GGCAAGGGGCAGGCTCGGGCTGG + Intronic
1200339300 X:155381978-155382000 GGCAAGGGGCAGGCTCGGGCTGG + Intergenic
1200347170 X:155458715-155458737 GGCAAGGGGCAGGCTCGGGCTGG - Intergenic