ID: 946180404

View in Genome Browser
Species Human (GRCh38)
Location 2:217945664-217945686
Sequence TGGTGAAAGCAGATGGACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 183}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946180398_946180404 21 Left 946180398 2:217945620-217945642 CCTCAATCTGTGAGAGTGTGGAT 0: 1
1: 0
2: 0
3: 13
4: 128
Right 946180404 2:217945664-217945686 TGGTGAAAGCAGATGGACTATGG 0: 1
1: 0
2: 0
3: 22
4: 183
946180402_946180404 -7 Left 946180402 2:217945648-217945670 CCACAAATGGCAAGGATGGTGAA 0: 1
1: 0
2: 0
3: 17
4: 186
Right 946180404 2:217945664-217945686 TGGTGAAAGCAGATGGACTATGG 0: 1
1: 0
2: 0
3: 22
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946180404 Original CRISPR TGGTGAAAGCAGATGGACTA TGG Intronic
900693218 1:3994362-3994384 TGGTGGAAGCAGATGCACTGAGG + Intergenic
901347550 1:8559733-8559755 TGATGCATGCAGATGGACTGTGG - Intronic
901587743 1:10312302-10312324 TGGTGAAAAGAGATGGAGTCAGG - Intronic
902864764 1:19270664-19270686 TGGTGAGAGCAGAGGCACCAGGG - Intergenic
902866983 1:19286101-19286123 TGGTGAGAGCAGAGGCACCAGGG - Intronic
906875380 1:49532606-49532628 AGGTGAAAGCACATGGTCAATGG - Intronic
912803650 1:112738394-112738416 TGCTGAAAGCAAAGGGAATACGG + Intergenic
917199705 1:172501516-172501538 TGGTAAAAGCACAGGGACTAGGG - Intergenic
918521814 1:185423299-185423321 TGCTGATAGCAGTTGGACTTGGG + Intergenic
920609277 1:207421883-207421905 TGGTGAAAGCATAGGGTCTAGGG + Intergenic
920724320 1:208419554-208419576 TGCTGTAAGCAGATGGTCAATGG + Intergenic
921412917 1:214855462-214855484 TGGAGAAAGAAGAGGGACTGTGG - Intergenic
922292360 1:224218999-224219021 AGCTGAAAGCAGATGGAGGAGGG + Intergenic
924472090 1:244351537-244351559 TGTTGAAAGCAGATAAGCTAGGG - Intergenic
924685981 1:246290215-246290237 TAGTGACAGAAGATGAACTATGG - Intronic
1063191541 10:3699120-3699142 TGGTGAAAGCAGGTAGATGAAGG + Intergenic
1067257750 10:44661005-44661027 TGGTGAAATCAGAGGGGATAAGG - Intergenic
1068559448 10:58497029-58497051 TGGTGAAAACAAATGGAATCTGG - Intergenic
1072000929 10:91194973-91194995 TGGTGAAAGCAGACAGTATAGGG + Intronic
1073985981 10:109209659-109209681 TGCAGAAAGTAGATGGACAAGGG + Intergenic
1074334189 10:112552257-112552279 TGGTGAAAGTAGATGGCATTTGG - Intronic
1075622362 10:123937193-123937215 TGGAGAAAGGAGCTGGACTTGGG + Intronic
1075625215 10:123959234-123959256 TGGTGAAAGCAGGAGGACTGTGG - Intergenic
1078088146 11:8247040-8247062 TTGTGGAAGCAGATGGGCCAAGG - Intronic
1079351372 11:19694724-19694746 TGGTTCATGCAGATAGACTAGGG + Intronic
1080386699 11:31814739-31814761 TGGAGAAAGGAGAGGGACAAAGG - Intronic
1081771406 11:45652361-45652383 TGGTGTGAGCAGAGGGACTGCGG - Intronic
1086721308 11:90124753-90124775 TGCTGAAAGCAAAGGGAATATGG + Intergenic
1090096303 11:123744620-123744642 TGCAGAAAGCAGAAGGAATAAGG - Intergenic
1090178250 11:124671092-124671114 TGGTGAAAACAGACAGACTTGGG - Intronic
1091544147 12:1489464-1489486 TGGTGAAAGCTGATGGGATTTGG - Intronic
1092379871 12:7986854-7986876 TGGTGGAACCAGATCTACTAGGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1100101454 12:91111426-91111448 TTCTTAAAGCAGATGCACTATGG + Exonic
1100744782 12:97633755-97633777 TGGTGAGGGCAGAGGGAGTAAGG + Intergenic
1100799505 12:98216467-98216489 GGGTGAAAGCAGAATGAGTAAGG - Intergenic
1102295255 12:111731348-111731370 TGGAGAAAGAAGATGGAGGAGGG - Intronic
1109437681 13:62327697-62327719 TGATGAGAGCATATGGACAAAGG + Intergenic
1110471866 13:75869262-75869284 AGGTGAAAGCAGTTGGTCTATGG - Intergenic
1115140679 14:30167979-30168001 TGGTGAAAGCAGGAGGAAGAAGG + Intronic
1116861376 14:49998235-49998257 TGGTGGCAGCAGATGGCCTGGGG + Intronic
1117447934 14:55822490-55822512 TGGTGCCAGCAGATCGATTAGGG + Intergenic
1118893726 14:69929233-69929255 TGGGGGAGGCAGATGGAGTAGGG - Intronic
1119565620 14:75626731-75626753 TAGTGAAACCAGATGGCCTTTGG + Intronic
1120645705 14:87071521-87071543 TGGGGAACACAGATGGAGTAGGG + Intergenic
1121385458 14:93518212-93518234 TGGTGAAGCCATATGGACTTGGG + Intronic
1126296993 15:47150804-47150826 TGGTGAAAGCAGAAGCAGGAGGG + Intergenic
1127279797 15:57479214-57479236 TGGAGAAGGCAGTTGGACCAAGG + Intronic
1128231084 15:66035943-66035965 TGCTGAAAGCAGGTGGGCTGAGG - Intronic
1131465416 15:92651020-92651042 TGGGGAAATCAGATTGATTAAGG + Intronic
1131655224 15:94449605-94449627 TGATGAAAGCAGAAGTCCTAGGG - Intronic
1135955341 16:26952165-26952187 TGCTGAAATCAGATGTCCTAAGG + Intergenic
1137822703 16:51461054-51461076 TGGTGAAAACACATGGACCCAGG - Intergenic
1138556783 16:57775535-57775557 TGGGGAAAGCGGATGGAAGATGG + Intronic
1141068814 16:80934869-80934891 TGGGGAAAGGAGATGGTCTTAGG + Intergenic
1141698652 16:85632501-85632523 TGGGGATAGCAGGTGGACAAAGG + Intronic
1142269157 16:89080134-89080156 TGGAGAAAGCAGAGGGAGGAAGG + Intergenic
1146575182 17:33984779-33984801 TGCTGAAAGGAGATGGAGGAAGG + Intronic
1147878305 17:43637409-43637431 TGGAGAAATCACATGGCCTATGG + Intergenic
1149224835 17:54457723-54457745 TGGTTAAAGCAAATGAAATATGG + Intergenic
1149335551 17:55632508-55632530 TGGTAGAAGCAGATGAGCTAGGG + Intergenic
1151272457 17:73007523-73007545 TGGTGAAAGCAAAAGGAGGAAGG + Intronic
1152980463 18:271401-271423 TGGTGAAGTAAGATGGACGAAGG + Intergenic
1153668810 18:7391153-7391175 TGGTTAAAGCAGATGGACGGTGG + Intergenic
1158678167 18:59541802-59541824 TGGTGATAGCAGCTGGAAGAAGG - Intronic
1159428865 18:68325131-68325153 GGGAGAAAACAGATGGGCTAGGG + Intergenic
1160030763 18:75257634-75257656 TGGTGTCTGCAGATGAACTAAGG + Intronic
1162308222 19:9888602-9888624 TGGCGGAAGCAGATGGAGTAGGG - Intronic
928427895 2:31193581-31193603 TGGTGATAGCAGCTGAATTAAGG + Intronic
930554772 2:52881980-52882002 TGAAGAAAGCAAATGGACTGTGG + Intergenic
931494958 2:62795481-62795503 TGGAGAAAGGAGTTGGACTGAGG - Intronic
932531873 2:72543117-72543139 TTGTGAGAGCACATGGAGTATGG + Intronic
933283112 2:80354561-80354583 TTGTGAAAGCAAATGGGATAAGG + Intronic
934861290 2:97765340-97765362 AGGTGAAAGGAGTTGGACGAAGG - Intronic
937238389 2:120444220-120444242 TGGTGAAAGCACATGGGCTTTGG + Intergenic
938387017 2:130873826-130873848 GGATGAAATCAGATGGACCAGGG - Intronic
939441913 2:142260776-142260798 TGGGAAAAGCTGATGGACAAGGG + Intergenic
939627721 2:144498554-144498576 TGGTGAAAGGAGAGGGATCATGG + Intronic
940393821 2:153164225-153164247 TGGAAAAGGGAGATGGACTATGG - Intergenic
940904101 2:159153378-159153400 AGGTGAAAGCAGAAGGAATTAGG + Intronic
941163711 2:162063215-162063237 TGCTGAAATAAGATGTACTAAGG + Intronic
941577829 2:167257147-167257169 TGGTGATAGCAGAGGGAGCAAGG - Intronic
942136247 2:172928521-172928543 TGGTGAAAGGAGATGTATTGGGG + Intronic
943739055 2:191391157-191391179 TGGTGAGGGCAGAAGGAATAAGG - Intronic
943853370 2:192756667-192756689 TGGTCATAGCAGAAGGATTAAGG - Intergenic
945357918 2:208860666-208860688 CTGTGAAAGCAGCTGGATTAGGG + Intergenic
946180404 2:217945664-217945686 TGGTGAAAGCAGATGGACTATGG + Intronic
946676215 2:222162548-222162570 TGGTGGGAGCAGAAGGAGTACGG + Intergenic
946856491 2:223955517-223955539 TGGTGAAGGCAGCTGGAATACGG - Intergenic
947011987 2:225576228-225576250 TGGTGGAACCAGATGAAGTAAGG - Intronic
1169792233 20:9423606-9423628 TGGGGAATGCAGATGGATCATGG + Intronic
1169938977 20:10916598-10916620 TGGTGAATGCAGAAGGAAGAAGG - Intergenic
1170488548 20:16845915-16845937 TGGTGAAGTCAGATGAACAAAGG + Intergenic
1172342695 20:34170974-34170996 TGGTGTGAACAGATGGACTAAGG - Intergenic
1172749596 20:37241215-37241237 TGGTGACAACAGAGAGACTAAGG - Intronic
1173065250 20:39704320-39704342 TGGTGAAGGCAGGTGGAGTGAGG + Intergenic
1174510919 20:51051819-51051841 TGATGAATCCAGCTGGACTAAGG - Intergenic
1174595435 20:51679669-51679691 TGGAGAAACCAGATGGACACTGG - Intronic
1178025277 21:28459305-28459327 GGGTGAGAGCTGATGGAATAGGG - Intergenic
1179019667 21:37627041-37627063 TGCTGAATGCAGGTGGATTAGGG + Intronic
1181375425 22:22454270-22454292 TGGTGGAGGCAGATGGTCTAAGG - Intergenic
949303271 3:2609298-2609320 TGGTGAAGGCAGAAGGGCAAAGG - Intronic
949320845 3:2808929-2808951 TGGTGAGACCTGTTGGACTAGGG - Intronic
950117912 3:10463320-10463342 CCGAGAAAGCAGTTGGACTATGG + Intronic
950465479 3:13150904-13150926 GTGTGAAAGCAGATGGTCCAGGG + Intergenic
950625008 3:14238846-14238868 TGCTGAGGGCAGAGGGACTATGG + Intergenic
951707540 3:25558447-25558469 GGATGAAAGCAGATGAACTGTGG - Intronic
951779817 3:26349715-26349737 TGCTGAGAGCAGATGGATTTTGG + Intergenic
952941315 3:38446432-38446454 AGGTGAAACCAGCTGGACTCTGG - Intergenic
954566441 3:51604057-51604079 TGGTGAAAGTAGTTGGATTCAGG + Intronic
954940666 3:54369472-54369494 TGGGGACAGCAGCTGGACAATGG - Intronic
955952441 3:64255917-64255939 TGGTGGCAGCAGCTGAACTATGG + Intronic
956061012 3:65348351-65348373 GGGTTAAAGCTGATGGACAAGGG + Intergenic
956232328 3:67030712-67030734 TGGGGAAAGGAGATAGACTAAGG - Intergenic
956282952 3:67577992-67578014 TGGTGAGAGCAGGTGAAGTAAGG + Intronic
956689656 3:71864019-71864041 TGGTGAAAACAGGTGGATAATGG + Intergenic
957587865 3:82155786-82155808 TGGTGAACTCAGATCCACTAGGG + Intergenic
959402515 3:105920774-105920796 TGGTGAGAGCACATGGACACAGG - Intergenic
960556880 3:119039665-119039687 TGGTGACAGCAGAATGACTAAGG - Intronic
961709019 3:128812663-128812685 TGATCAGAGCACATGGACTATGG - Intronic
961728208 3:128946820-128946842 TAGTGAAATCAGATGCACCAAGG + Intronic
962391185 3:134974133-134974155 TGGGGAGAGGAGATGAACTAGGG - Intronic
963383607 3:144562106-144562128 TGGTGAATGCTGAAGGTCTAAGG + Intergenic
963833787 3:150035920-150035942 TGGTGATATCAGATGAAATATGG + Intronic
972606948 4:40622432-40622454 TGGTTAAAGCAGAGGAAGTAAGG + Intronic
972696944 4:41456500-41456522 TGGTCAAAGAAGATGGTCAAGGG - Intronic
976035803 4:80819324-80819346 TGGTGAATGCAGATGACCTAGGG + Intronic
976770561 4:88647595-88647617 AGGTTAAAGAAGATGGACAATGG + Intronic
978739591 4:112121750-112121772 TGGGGAAAGTAAAGGGACTAAGG + Intergenic
979291838 4:118986791-118986813 TGGTGAAATGAGATGGAAAAAGG - Intronic
980904921 4:138939007-138939029 TGGTGACAACAGATGGAACAAGG + Intergenic
981116915 4:141002387-141002409 TGGGGGAGGCAGATGGATTAAGG - Intronic
984668854 4:182458765-182458787 TGGTGAATGCAGCTTGCCTAAGG + Intronic
984998937 4:185465890-185465912 TGGTGAGAGCAGATGGATGAGGG + Intronic
989142426 5:38214781-38214803 GGGTGACAGGAGATGGAGTATGG + Intergenic
989240496 5:39197594-39197616 TGGGGAAAGCAAATGCACTCTGG + Intronic
989648302 5:43660817-43660839 TGGTGGAAGGTGATGGATTATGG - Intronic
990181417 5:53164696-53164718 TGGTAAAAACAGAAGGACAAAGG + Intergenic
992123085 5:73614504-73614526 TGGTGAAACCAGGTGGATCAGGG + Intergenic
992376186 5:76190044-76190066 TGGTGGAAGCAGAAGGAAGATGG + Intronic
992872744 5:81022941-81022963 TGGTGAAACCAAATGGGCAAGGG + Intronic
993826114 5:92688857-92688879 TGTGGAAAGCAATTGGACTATGG - Intergenic
994874381 5:105397602-105397624 TCGTGCATCCAGATGGACTAAGG + Intergenic
996381466 5:122866481-122866503 TGCTGAAGGCAAATGGAATATGG - Intronic
997179771 5:131815867-131815889 TGCTGAAGGCAGAAGGAATATGG + Intronic
997962570 5:138333672-138333694 TGGCAAAAGCAGATAGATTATGG + Intronic
999253713 5:150197384-150197406 TGGTGATGGCAGGTGGACTCTGG + Intronic
999719856 5:154391660-154391682 TGCTTAAATCAGATTGACTAAGG - Intronic
1001631689 5:173180041-173180063 TGCTGAGAGCAGAGGGTCTAAGG + Intergenic
1001906192 5:175475644-175475666 TGGGAAAAGCAGATGGATGAAGG - Intergenic
1002002555 5:176206272-176206294 TGGTGAAAGCAGAAGGAAGAGGG + Intergenic
1002224045 5:177705340-177705362 TGGTGAAACCAGAAGGAAGAGGG - Intergenic
1002353976 5:178608627-178608649 TGATGTGAGCATATGGACTATGG - Intronic
1005152206 6:22765258-22765280 TGGTGAAAGAAGAACGGCTAAGG - Intergenic
1005298311 6:24447768-24447790 TGGTGAAATGATATGGAATAAGG + Intronic
1006040193 6:31246140-31246162 TGCTGAAGGCAGTGGGACTATGG - Intergenic
1006303125 6:33204549-33204571 TGGTGGCCGCAGATGGCCTAAGG + Intergenic
1007724739 6:43908527-43908549 TTTTCAAAGAAGATGGACTAGGG - Intergenic
1008395530 6:51002474-51002496 TGGAGAAAACAGAAGGTCTAAGG - Intergenic
1009816737 6:68746859-68746881 AAGGGAAAGCAAATGGACTATGG - Intronic
1010660388 6:78563697-78563719 TGGTCACAGAAGAGGGACTAAGG - Intergenic
1011933096 6:92738286-92738308 CTGTGAAAGCAGCTGGAATAGGG + Intergenic
1012191617 6:96287100-96287122 TGGAGAAAGCATATGGCCTGGGG + Intergenic
1012694524 6:102361795-102361817 TGATTAAAACATATGGACTAAGG + Intergenic
1013551412 6:111211184-111211206 AGGTGAGAGATGATGGACTATGG + Intronic
1013870235 6:114749281-114749303 AGGTGAAAGCAGGAGAACTAAGG + Intergenic
1016886181 6:148961866-148961888 TGCTGAAAGAAGATGGAATGAGG + Intronic
1017043058 6:150323278-150323300 TGCTGGAAGCAGATGCACTCTGG + Intergenic
1017628853 6:156376201-156376223 TGGTGAGTTCAGAGGGACTATGG + Intergenic
1018399778 6:163411414-163411436 TGGGGTAAGCAGATGGAAGAAGG + Intergenic
1022494735 7:30845734-30845756 CTGTGAAAGCAGATGGAGGATGG + Intronic
1027498235 7:78915174-78915196 TGGAGAAAGCAGAGGGCCCACGG + Intronic
1028278220 7:88886204-88886226 TGGTGATGGTAGATGGATTAGGG + Intronic
1032291816 7:130595979-130596001 TGGAGGAAGCAGAGGCACTACGG - Intronic
1034009604 7:147514878-147514900 GGGTGAAAGTAGGTCGACTAAGG - Intronic
1035083500 7:156236754-156236776 TGGAGAGAGCAGGTGGCCTAGGG + Intergenic
1035484906 7:159215281-159215303 TGGGAAAAGCAGAGGGACTCAGG + Intergenic
1038898778 8:31818480-31818502 TGGGGAAAGGAGATGGTTTAGGG + Intronic
1044346266 8:91107802-91107824 TGGTGAATGCATTTGGACTGTGG + Intronic
1045607702 8:103795964-103795986 TGGTGCAATAAGATGGGCTAGGG - Intronic
1046275690 8:111957082-111957104 TGGTGAAAGCACATGGCCCTTGG + Intergenic
1046590970 8:116206750-116206772 TGGATAAAGCACATAGACTAGGG - Intergenic
1048580167 8:135724052-135724074 GTGTGAAAGCAGAAGGACAATGG - Intergenic
1049647861 8:143744224-143744246 TGGAGACTGCAGATGAACTAAGG - Intergenic
1051531785 9:18112247-18112269 AGGTGAACTCAGATGGACTAAGG - Intergenic
1052688219 9:31780773-31780795 TTGTGAAAGCAGATGGGATTAGG - Intergenic
1053608761 9:39688172-39688194 TGGTGGAATCAGATGGGCTATGG - Intergenic
1053866606 9:42444538-42444560 TGGTGGAATCAGATGGGCTATGG - Intergenic
1054244763 9:62654226-62654248 TGGTGGAATCAGATGGGCTATGG + Intergenic
1054558890 9:66688769-66688791 TGGTGGAATCAGATGGGCTATGG + Intergenic
1058106630 9:100979334-100979356 TAGTGAAAAAAAATGGACTAAGG - Intergenic
1060273930 9:122167935-122167957 CGATGAAAGCAGAGGGACGAAGG - Intronic
1186152860 X:6693436-6693458 TGGAGATAGCAAATGTACTAGGG - Intergenic
1187718217 X:22124961-22124983 TGGTTAAACCAGAAGAACTAAGG - Intronic
1189995658 X:46634784-46634806 TGGTGAAAGCAGTGGGACATGGG - Intronic
1190243378 X:48675244-48675266 TGGTGAAGGCAGATGCCTTAGGG + Intergenic
1190446389 X:50529258-50529280 TGGTGCAAGAAAATAGACTATGG - Intergenic
1192549430 X:72042213-72042235 TGCTGAAATCACAGGGACTAGGG - Intergenic
1193832200 X:86303108-86303130 TGGTTTAAGAACATGGACTATGG - Intronic
1195097105 X:101513701-101513723 TGCTGAGAGCAGAGGGAATATGG - Intronic
1198974570 X:142321866-142321888 GGGTGGAAGCAGAAGAACTAGGG - Intergenic
1199473437 X:148220318-148220340 TGGGGAAAGCAAATGGGCTTGGG + Intergenic
1199735395 X:150681192-150681214 TGGTGGAAGCAAATGCTCTATGG + Intergenic
1200292007 X:154884421-154884443 GACAGAAAGCAGATGGACTAGGG + Intronic
1200338845 X:155380158-155380180 GACAGAAAGCAGATGGACTAGGG + Intergenic
1200347624 X:155460534-155460556 GACAGAAAGCAGATGGACTAGGG - Intergenic