ID: 946181094

View in Genome Browser
Species Human (GRCh38)
Location 2:217949349-217949371
Sequence CTCCAGGGCAGGGTTTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 332}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946181079_946181094 28 Left 946181079 2:217949298-217949320 CCCCTGAGAAGCATAATTTTAAA 0: 1
1: 0
2: 2
3: 40
4: 460
Right 946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG 0: 1
1: 0
2: 4
3: 46
4: 332
946181088_946181094 -6 Left 946181088 2:217949332-217949354 CCTGGGGCTCTAGCTGCCTCCAG 0: 1
1: 0
2: 0
3: 46
4: 331
Right 946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG 0: 1
1: 0
2: 4
3: 46
4: 332
946181081_946181094 26 Left 946181081 2:217949300-217949322 CCTGAGAAGCATAATTTTAAAGC 0: 1
1: 0
2: 3
3: 15
4: 278
Right 946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG 0: 1
1: 0
2: 4
3: 46
4: 332
946181087_946181094 -5 Left 946181087 2:217949331-217949353 CCCTGGGGCTCTAGCTGCCTCCA 0: 1
1: 0
2: 1
3: 17
4: 247
Right 946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG 0: 1
1: 0
2: 4
3: 46
4: 332
946181080_946181094 27 Left 946181080 2:217949299-217949321 CCCTGAGAAGCATAATTTTAAAG 0: 1
1: 1
2: 0
3: 42
4: 380
Right 946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG 0: 1
1: 0
2: 4
3: 46
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946181094 Original CRISPR CTCCAGGGCAGGGTTTCCCT TGG Intronic
900148293 1:1167681-1167703 CTCCAGGGCAAGGGGACCCTGGG - Intergenic
900314703 1:2050900-2050922 CCCCGGGACCGGGTTTCCCTGGG + Intronic
900741187 1:4332358-4332380 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741217 1:4332445-4332467 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741228 1:4332474-4332496 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741239 1:4332503-4332525 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741250 1:4332532-4332554 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741261 1:4332561-4332583 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741281 1:4332619-4332641 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741292 1:4332648-4332670 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741301 1:4332677-4332699 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741312 1:4332706-4332728 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741322 1:4332735-4332757 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741340 1:4332793-4332815 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741360 1:4332851-4332873 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741379 1:4332909-4332931 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741398 1:4332967-4332989 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741408 1:4332996-4333018 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741417 1:4333025-4333047 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741427 1:4333054-4333076 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741437 1:4333083-4333105 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741446 1:4333112-4333134 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741465 1:4333170-4333192 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741496 1:4333259-4333281 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741527 1:4333348-4333370 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741537 1:4333377-4333399 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741558 1:4333435-4333457 CTCCAGGGAAGGGGTTTCCTGGG - Intergenic
900741578 1:4333493-4333515 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
900741597 1:4333551-4333573 CTCTAGGGAAGGGGTTTCCTGGG - Intergenic
901130579 1:6960389-6960411 CTCCAGGGCAGGGAGTCATTGGG + Intronic
901207722 1:7506311-7506333 CTCCAGGGCAGGGCTGGGCTGGG - Intronic
901443548 1:9293330-9293352 CTGCAGGGCAGGGGGTCCCGGGG + Intronic
902646378 1:17802311-17802333 CTGCTGGGGAGTGTTTCCCTGGG + Intronic
902870144 1:19309040-19309062 CTCCAGGGAAGGCTTTCTCTAGG + Intronic
903059545 1:20660559-20660581 CTCCTGGGTTGGGTTTGCCTGGG - Intronic
903261122 1:22132352-22132374 CCCAAGGGCAGGGGTTCTCTGGG + Intronic
903670217 1:25031048-25031070 CTCCAGGGCTGGGTTTCCCAGGG + Intergenic
904036642 1:27562480-27562502 CACCAAGGCAGGGTTTGCATGGG - Intronic
904092455 1:27954866-27954888 CTCAAGGGCAGGGCATCCCCTGG - Intronic
904392929 1:30197626-30197648 CTGCTGGGTAAGGTTTCCCTGGG - Intergenic
904605851 1:31697173-31697195 CTCCAGCACAGTGTGTCCCTGGG + Intronic
904701480 1:32361077-32361099 CTCCTGGGCAGCCTTTCCCTTGG - Intronic
904775719 1:32905013-32905035 CCCCAGGGCAGGGGCTCCCAGGG + Intergenic
905581309 1:39084333-39084355 TTCCAGGGCAAGGTGTCCCCTGG - Exonic
905617293 1:39409581-39409603 CTACAGCGCAGGGTTGGCCTGGG + Intronic
907974559 1:59418922-59418944 CTACAGGCCAGGGTTTCCTAGGG + Intronic
908401303 1:63774654-63774676 CGCCAGGCCAGGGTTTGCCCCGG + Intronic
908401315 1:63774682-63774704 CGCCAGGCCAGGGTTTGCCCCGG + Intronic
909643192 1:77888945-77888967 CTCCAAGGCAGGGTTCGCCCGGG - Intronic
912010141 1:104948753-104948775 CACAAGGGCAGAGTTTCCCAAGG + Intergenic
912645374 1:111387114-111387136 CTCCCAGGGAGGGTTTCTCTGGG - Intergenic
914386180 1:147172272-147172294 CTCCAGGGCTCGGCTTCCCTGGG - Intronic
915901310 1:159848471-159848493 CTCCAGAGCAGGGGTTTCCCAGG + Intronic
916210889 1:162359034-162359056 GGCCAGGGCAGGATTTCCCATGG - Intronic
917519167 1:175733866-175733888 CACCAGGGCATGGTTTCCCTGGG - Intronic
917529701 1:175823576-175823598 CTCCAGGGCTGGGTTTTGCAAGG + Intergenic
917981904 1:180274737-180274759 CACTAGGGCATTGTTTCCCTGGG + Exonic
918011963 1:180595231-180595253 CCCCAGGGAAGGGATTTCCTTGG - Intergenic
920578879 1:207085989-207086011 CTCCAGGACAGGGTCCTCCTGGG - Intronic
922353294 1:224753034-224753056 CTCCAGGGCATGATTTACTTTGG - Intergenic
922710743 1:227829013-227829035 CTTGAGGGCAGGGATTCCTTTGG + Intronic
923211634 1:231808807-231808829 CCCCAGGCCAGGTTTTACCTGGG - Intronic
1063566348 10:7174753-7174775 TTCCAGGGGAGGGCTTCACTGGG - Intronic
1067848924 10:49743007-49743029 CCCCAGGGCTGGCTGTCCCTTGG - Intronic
1068069981 10:52183454-52183476 CTCAAGGGCAGGTTCTTCCTGGG + Intronic
1071017809 10:81019218-81019240 CTATAGGGCAGTGGTTCCCTTGG + Intergenic
1071737487 10:88318134-88318156 CTCAAGGGCAGAGATTCCCTGGG - Intronic
1072625191 10:97106821-97106843 TTCCAGGGCAGGCTTACTCTAGG - Intronic
1072692358 10:97580483-97580505 CTCTAGGCCAGGGCTTCCCTAGG - Intronic
1074528533 10:114281100-114281122 CTCTAGGGCAGGGTCTTCCCTGG - Intronic
1075219923 10:120576017-120576039 GTCTAGGGAAGGGTTTCCCAAGG + Intronic
1075699088 10:124456975-124456997 CTCCAGGGCAAGTGTTCCCAGGG - Intergenic
1075708222 10:124515685-124515707 CACCAGAGCAGGGTTGCCCTGGG + Intronic
1076854115 10:133106851-133106873 CTCCTGGGCAGTGTTTATCTGGG + Intronic
1076926173 10:133489074-133489096 CTCAAGGGCAGTTTTGCCCTGGG + Intergenic
1077093639 11:790313-790335 CTCTAGGCCAGGGTGCCCCTTGG + Intergenic
1077158249 11:1101085-1101107 GTCCAGGGCACGGCTTCCCTTGG + Intergenic
1077173409 11:1178337-1178359 CCGCAGGGCAGGGTGGCCCTGGG + Intronic
1079104505 11:17561600-17561622 TTGCAGGGCAGAGTTCCCCTGGG + Intronic
1080416528 11:32074320-32074342 CACCAGGGCAGTGTTTCTCAAGG + Intronic
1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG + Intergenic
1083157730 11:60835459-60835481 CACCAAGGCAGGGTTTCCAGGGG + Intergenic
1083599792 11:63939474-63939496 CTCCAAGCCAGGGTTGACCTCGG - Intronic
1083897915 11:65629440-65629462 CTTTAGGGCAGGGCCTCCCTGGG + Intronic
1084563211 11:69915553-69915575 CTGCAGGGCATGGTTGCCCTGGG + Intergenic
1084751149 11:71205089-71205111 ATCCAGGGCTGGGACTCCCTGGG - Intronic
1084821749 11:71696124-71696146 CTCCAGGGACAGGTCTCCCTGGG + Intergenic
1084860419 11:72014434-72014456 CTCCAGGGCAAGGTCAGCCTGGG + Exonic
1085555081 11:77412145-77412167 CTCCAGGGCCAGGTTTTCCAGGG + Intronic
1088559403 11:111097452-111097474 CTTGAAGGCAGGGTTTCGCTGGG + Intergenic
1088764648 11:112963212-112963234 CCGCAGGGCGGGGTTTCTCTTGG - Intronic
1088838546 11:113602416-113602438 TTCCCGGGCAGGGCTTCTCTTGG - Intergenic
1089554363 11:119307514-119307536 CTGCAGGGCCTGGTTTCCCCAGG + Exonic
1089572737 11:119420977-119420999 CACCAGGGCTGGGGGTCCCTGGG + Intronic
1089861396 11:121593150-121593172 GTCCAGGGCATGATTTGCCTTGG + Intronic
1090211080 11:124921405-124921427 CTCCGGGGCCGGGTTCTCCTCGG + Exonic
1091094788 11:132810315-132810337 CACCTAGGCAAGGTTTCCCTGGG - Intronic
1092465237 12:8725635-8725657 CTCCAGAGCAGGGCTCCCCTTGG - Intronic
1092770340 12:11891080-11891102 CTGGTGGGCAGGGGTTCCCTGGG - Exonic
1093977195 12:25436352-25436374 CTCCCGAGCCAGGTTTCCCTTGG - Intronic
1094825216 12:34264403-34264425 CGCCAGGGCAGAGGTTCCCTAGG - Intergenic
1098885191 12:75953794-75953816 CTACATGGGAGGTTTTCCCTTGG - Intergenic
1100163560 12:91890909-91890931 CTCCAGGGCAATGCTTACCTTGG - Intergenic
1103564155 12:121807003-121807025 CTCCCAGGCAGGGTTTCCCAGGG - Intronic
1105373070 13:19818144-19818166 CTCCAGGACAGGCTTCCTCTTGG + Intergenic
1105606406 13:21929913-21929935 CTCCATGACAGGGCTTACCTAGG - Intergenic
1105885324 13:24637089-24637111 CTCCAGGGTGGGCTTTCCCACGG - Intergenic
1107101448 13:36597799-36597821 CCCTAGGCCAGGTTTTCCCTGGG - Intergenic
1107372856 13:39771437-39771459 CAGCAGGGCCGGGTCTCCCTGGG - Intronic
1107969506 13:45627779-45627801 CCCCAGGGCAGTGCTTCCTTTGG + Intergenic
1109932562 13:69235007-69235029 CTCTAGGGCAGGGGATCCCAAGG + Intergenic
1110235131 13:73209898-73209920 CTCCAGGGCTGTACTTCCCTTGG + Intergenic
1110906670 13:80898364-80898386 CTCCAAAGTAGGCTTTCCCTTGG + Intergenic
1112518436 13:100076327-100076349 CTCCAGAGCAGAGTAACCCTTGG + Intergenic
1113742573 13:112721691-112721713 CTCCACGGCTGGGCTTCCCGGGG + Intronic
1113766471 13:112883735-112883757 CCTCAGGGCAGGGTGGCCCTGGG - Exonic
1113868751 13:113545630-113545652 CTTCAAGGCAGGGCTGCCCTGGG - Intronic
1113868766 13:113545695-113545717 CTTCAAGGCAGGGCTGCCCTGGG - Intronic
1113992890 14:16042337-16042359 CTGCAGGGCGGAGGTTCCCTAGG - Intergenic
1114668835 14:24398499-24398521 CTCCAGCCCAGAGTTTCCTTAGG + Intergenic
1116205395 14:41858921-41858943 CTCCAGGGCAGGATTTGTATGGG - Intronic
1121338416 14:93090985-93091007 CACCATGGAAAGGTTTCCCTGGG + Intronic
1121740108 14:96245954-96245976 CACTATGGAAGGGTTTCCCTTGG - Intronic
1122261748 14:100527556-100527578 CTCCACTGCAGGGTGTCCCAGGG + Intronic
1122414256 14:101541242-101541264 CTCCACGGCAGGGAATTCCTGGG + Intergenic
1122745037 14:103892452-103892474 CTCCAGGCCAGGGCCTGCCTCGG + Intergenic
1123121338 14:105918416-105918438 GTCCAGGTCAGGGTGGCCCTGGG + Exonic
1126468589 15:48983325-48983347 TTCCAGGGCAGCCATTCCCTGGG + Intergenic
1126713099 15:51483500-51483522 CTCAAGGGCAGGTTCACCCTGGG - Intronic
1127016542 15:54695163-54695185 CTTGAAGGCAGGGTTTCACTGGG - Intergenic
1127293872 15:57592713-57592735 CTCCAGGGAAGGTTTCCCTTTGG + Intronic
1127861079 15:62994737-62994759 CTCCAGGCCCTGGTCTCCCTTGG - Intergenic
1131121880 15:89827971-89827993 CTCCAGGGCAGGGGAGCCCAGGG + Intergenic
1131173129 15:90192291-90192313 CTCCAGAGCCAGGTTCCCCTGGG + Intronic
1131198543 15:90376855-90376877 CTGCATGGCAGGGTTCCCCACGG - Intergenic
1132593223 16:735581-735603 CCCCAGGCCAGGTTTTCCCTGGG + Intronic
1132633040 16:928984-929006 CGCCAGGGCAGGGCTTCCTCTGG - Intronic
1132640887 16:977759-977781 CTCCAGGGTGGCATTTCCCTGGG + Intronic
1132748354 16:1446222-1446244 TTCCAGGGCAGGGCAGCCCTCGG + Exonic
1132833670 16:1942107-1942129 CTCCAGGGGAGGCTGTCCCCAGG - Intronic
1132853237 16:2034097-2034119 CTGCGGGGCAGGGTTTCTCAGGG - Intronic
1134048657 16:11121360-11121382 CACTTGGGCAAGGTTTCCCTAGG + Intronic
1134803480 16:17106326-17106348 CCTCTGGCCAGGGTTTCCCTGGG - Exonic
1136024598 16:27461546-27461568 CTCCAGGGCCTGGAGTCCCTCGG - Exonic
1136098359 16:27974939-27974961 CTTCAGACCTGGGTTTCCCTTGG - Intronic
1136397729 16:30002224-30002246 CTCCTGGGCAGTGTTTCTGTCGG + Intronic
1136519409 16:30786569-30786591 CTCCATGTCAGGGTCACCCTGGG - Intronic
1136912259 16:34154089-34154111 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic
1139365382 16:66429330-66429352 CTTCAGAGCAGGGTGTCCCCAGG + Intronic
1141330756 16:83108679-83108701 CTCGAAGGCAGGGTTTTGCTGGG + Intronic
1141679509 16:85536107-85536129 CTCCTGGGGACCGTTTCCCTGGG - Intergenic
1143145662 17:4773527-4773549 CTCCAGGGGAGAGCTCCCCTTGG + Intronic
1143316451 17:6036867-6036889 CTCCAGGTCAGCGTTTGCCCAGG - Intronic
1143527857 17:7482808-7482830 CACCAGGGCAGGGTGGGCCTTGG - Exonic
1143764816 17:9130531-9130553 CTCCTGGGCAGCCTTCCCCTGGG + Intronic
1144934008 17:18883135-18883157 CTTCAGGACAGTGGTTCCCTAGG - Intronic
1146730900 17:35193462-35193484 CACCAGGGCAGGGTGGGCCTTGG + Exonic
1147718473 17:42523183-42523205 CTCCAGGGCAGGGGCTGCCCAGG + Intergenic
1149516771 17:57286970-57286992 CTCCAGGCCAGCCTCTCCCTAGG - Intronic
1152606595 17:81294717-81294739 CGCCGGGGCAGGGCTTCGCTGGG - Intronic
1154115597 18:11610419-11610441 CACCAGGGCAGGGTGGGCCTTGG - Intergenic
1154120044 18:11644634-11644656 CACCAGGGCAGGGTGGGCCTTGG - Intergenic
1154334741 18:13456376-13456398 CACCTTGCCAGGGTTTCCCTGGG + Intronic
1155035315 18:22020779-22020801 CTCCAGGGCATGGTGTTTCTGGG + Intergenic
1155668879 18:28345318-28345340 TTCCAGGACATGGTATCCCTGGG - Intergenic
1155819804 18:30361497-30361519 CTTCAAGGTAGGGTTTCACTGGG - Intergenic
1158043069 18:53120893-53120915 CTCCAGGGCAGGGATTACTGAGG + Intronic
1158272937 18:55736258-55736280 CTCAAGGAAAGGGTTTCCATTGG - Intergenic
1160040832 18:75344282-75344304 GTCTAGGGCAAGGTGTCCCTGGG + Intergenic
1160929735 19:1564768-1564790 CTCCAGGGAAGGGGTAACCTTGG + Intronic
1162111729 19:8403338-8403360 CTGCAGGGAGGGGTTCCCCTCGG + Intronic
1162217790 19:9150575-9150597 CTAAAGGTCAGGGTTCCCCTGGG - Intronic
1162680303 19:12335430-12335452 CTGCAGGTCAGGGTGGCCCTGGG + Intergenic
1164671484 19:30074535-30074557 CTCTAGGGAAGGGGTTCCCTAGG + Intergenic
1164694791 19:30235172-30235194 CCCCAGGGAAGGGCCTCCCTTGG + Intronic
1164719883 19:30424351-30424373 CTCCAGGGCAGGGCTGACCGAGG + Intronic
1165182628 19:33985831-33985853 CTCCTGGGGAGGGTTTCTCCAGG - Intergenic
1165436216 19:35796947-35796969 CTCCTGGGCAGGGATCCGCTAGG + Intergenic
1165994093 19:39832663-39832685 CACCAGGGCACGATTTTCCTAGG + Intronic
1166908643 19:46134310-46134332 CTCCAGGGACTGGTTTCCCAAGG + Intergenic
1167311865 19:48741609-48741631 CCCGAGGACAGGGGTTCCCTTGG - Intronic
1168523560 19:57071391-57071413 GTCCAAGGCAGGGTTTGCCAAGG - Intergenic
925203708 2:1989369-1989391 CTCCTGGGCTGGGTTTCTCCTGG - Intronic
925232173 2:2243113-2243135 CTTCAGGGCAGCCTCTCCCTTGG - Intronic
925387837 2:3474606-3474628 CTCCAGGGCGGCGTTTCCCCGGG + Intronic
925736367 2:6967496-6967518 CTCCAGGGCAGGGTGCCACAGGG - Intronic
928174158 2:29022933-29022955 CCTCAGAGCAGGGTTTCCCGGGG - Intronic
928708944 2:33982695-33982717 CACCAGGTGAGTGTTTCCCTTGG + Intergenic
929996477 2:46829256-46829278 GTGCAGGGCAGGGTTGACCTTGG - Intronic
930866854 2:56130479-56130501 CTCCCAGGTTGGGTTTCCCTGGG - Intergenic
930980727 2:57523495-57523517 GTACAGGGCAGTGTTTCCCTGGG - Intergenic
931221121 2:60288982-60289004 GACCAGGGCAGGGTTTTCCATGG - Intergenic
932827834 2:74958286-74958308 CTCCAGGGCCGGGCCTCCCTCGG + Intergenic
937991374 2:127664230-127664252 CGGCAGGGCAGGCCTTCCCTCGG - Intronic
938323439 2:130381063-130381085 CTCCAGAACAGGGTGTCCCATGG - Intergenic
938538810 2:132268544-132268566 AGCCAGGGCAGAGGTTCCCTAGG + Intergenic
940133072 2:150406302-150406324 ATGCAGGACAGGGCTTCCCTGGG - Intergenic
940983066 2:160024487-160024509 AGCCAGGGTAGGGATTCCCTGGG - Intronic
942022318 2:171878512-171878534 CTCCAAGCCAGAGTTTCCCTGGG + Intronic
942566383 2:177268266-177268288 ATCAAAGGCAGGGTTTCCCCTGG + Intronic
944620009 2:201504770-201504792 TTCCATGCCAGGTTTTCCCTGGG + Intronic
945466089 2:210171565-210171587 CTCTGGTGCAGGGTTTACCTCGG + Intergenic
946181094 2:217949349-217949371 CTCCAGGGCAGGGTTTCCCTTGG + Intronic
946199588 2:218064132-218064154 CTCCAGTGCAGAATTTCCCAGGG - Intronic
947262865 2:228243302-228243324 CTCCAGGATTGGGTTTCCTTGGG - Intergenic
948431662 2:237922832-237922854 CTCCAGGGCAGGGGTGGCCCCGG - Intergenic
948915029 2:241030153-241030175 GTCCTGGGCAGGGTATCCCCAGG - Intronic
948915583 2:241033668-241033690 GGACAGGGCAGGGCTTCCCTGGG + Intronic
1168983292 20:2026141-2026163 CTCCATGGCTGGCTTACCCTTGG - Intergenic
1169068530 20:2707830-2707852 CCCTGGGGCAGGGTCTCCCTGGG + Intronic
1169498253 20:6134869-6134891 CTCCAGGCCAGGTTTTGCCTGGG - Intergenic
1170594024 20:17792219-17792241 TGCCAGGGCAGGGTGTGCCTCGG + Intergenic
1170902919 20:20483587-20483609 CTGCAGGGCAGGTCTTCTCTTGG + Intronic
1171769004 20:29307148-29307170 CGCCAGGGCGGAGGTTCCCTAGG + Intergenic
1171867721 20:30500505-30500527 CGCCAGGGCAGAGGTTCCCTAGG + Intergenic
1172173581 20:32959445-32959467 GGCAAAGGCAGGGTTTCCCTGGG + Intronic
1172175969 20:32972077-32972099 CTATAGGGAAGGGTTTCCCCAGG + Intergenic
1172307253 20:33889394-33889416 CTCCAGTGGAGGGTCTGCCTAGG - Intergenic
1173468134 20:43300774-43300796 CACTAGGACAGGGTGTCCCTGGG - Intergenic
1173482784 20:43416427-43416449 CTCAAGGGCAGGTTTGCCCTGGG - Intergenic
1174296050 20:49545921-49545943 CACCAGGGCAGGGTTTGCACAGG + Intronic
1176059905 20:63168002-63168024 CCACAGGGCGGAGTTTCCCTGGG - Intergenic
1176552727 21:8236019-8236041 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic
1176571625 21:8418422-8418444 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic
1176579537 21:8462985-8463007 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic
1179710769 21:43211823-43211845 CTCCCGGGCAGGGCTCCCCTCGG + Intergenic
1180314380 22:11265182-11265204 CTGCAGGGCGGAGGTTCCCTAGG + Intergenic
1180340978 22:11618369-11618391 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic
1181033873 22:20160787-20160809 CACAGGGGCAGGGTGTCCCTGGG + Intergenic
1181161556 22:20962922-20962944 CTCCAGGGCTGGGGGTGCCTAGG + Intergenic
1181162603 22:20967096-20967118 CCACAGAGCAGGGTTTCCCTGGG + Intronic
1181419579 22:22788648-22788670 CCACAGGGCTGGGATTCCCTGGG + Intronic
1181509481 22:23382616-23382638 CACAGGGGCAGGGTGTCCCTGGG - Intergenic
1183416787 22:37687149-37687171 GTCCAGTGCAGGGTTTCCGAAGG + Intronic
1183628358 22:39018379-39018401 CTCCAGTGAGGGGTCTCCCTGGG + Exonic
1183630963 22:39032308-39032330 CTCCAGTGAGGGGTCTCCCTGGG + Exonic
1184767281 22:46578267-46578289 CACCAGGGCAGGGCTGCACTGGG - Intronic
1185103765 22:48855774-48855796 GACGAGGGCAGGGTTTCCGTGGG + Intergenic
1185315893 22:50178977-50178999 AGCCCGGGCAGGGCTTCCCTCGG + Exonic
1203257706 22_KI270733v1_random:152421-152443 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic
949245696 3:1923532-1923554 CCCCAGTGCACAGTTTCCCTGGG - Intergenic
950576215 3:13833632-13833654 CTACGGGGCAGGGGTTGCCTTGG + Intronic
951755170 3:26083162-26083184 CTCCAGGGCAGGATTTAATTGGG - Intergenic
952901481 3:38114592-38114614 TTCCAGGCCAGGGTTTCCCTGGG + Intronic
953748049 3:45590324-45590346 CTCCATGGCTGGCTTGCCCTTGG - Intronic
953905542 3:46866690-46866712 CTCCAGGACAGGGTTTAGCAAGG - Intronic
955238327 3:57159549-57159571 CTCCTGGGCAGTGTTTGTCTTGG - Intronic
955396255 3:58559841-58559863 CTCCAAGGAAGGGTTTCCCATGG - Intergenic
956203140 3:66728358-66728380 CTCCAGAGCAGGGTGACTCTAGG + Intergenic
956789480 3:72669428-72669450 CTCCATGTCATGGTTTGCCTGGG - Intergenic
960334620 3:116401062-116401084 CTGGAGGCCAGGGTTTACCTAGG - Intronic
961200700 3:125043248-125043270 CTCCAGGCCAGGCCTCCCCTGGG - Intronic
961381415 3:126498564-126498586 CTCCAGGACAGGGCTGTCCTGGG + Intronic
967555338 3:190850354-190850376 CTTGAAGGCAGGGTTTCACTGGG - Intergenic
967610466 3:191499874-191499896 CGCCTGGGAAGGGTTTCCCTCGG - Intergenic
968085398 3:195871906-195871928 CTCCAGGGGAGGGTTCTCCGGGG - Intronic
968085405 3:195871921-195871943 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085415 3:195871951-195871973 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085421 3:195871966-195871988 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085427 3:195871981-195872003 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085437 3:195872011-195872033 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968085443 3:195872026-195872048 CTCCAGGGGAGGGTTCTCCAGGG - Intronic
968443944 4:638988-639010 CCCCAGGCCAGCTTTTCCCTGGG - Intronic
968476849 4:814679-814701 CCCCAGGCCAGGTTTTCCCCAGG + Intronic
968520213 4:1031692-1031714 CTGCAGGGCTGGATGTCCCTGGG - Intergenic
968883633 4:3315285-3315307 CCCCAGGCCAGTGATTCCCTAGG - Intronic
968884721 4:3321650-3321672 CCCCAGGGCAGGGTTTTCTGTGG + Intronic
969632173 4:8345194-8345216 CTCCACGGCCGGGCTGCCCTGGG - Intergenic
970186107 4:13455327-13455349 CTCAAGGGCAGGTTTGCCCTGGG + Intronic
971244212 4:24913346-24913368 CCCGAGGGCAGGGGTTTCCTTGG + Intronic
971343959 4:25795660-25795682 CTCCAGGGCCAGATTTGCCTGGG - Intronic
971500813 4:27316297-27316319 ATCCCGGGCAAAGTTTCCCTGGG + Intergenic
973057317 4:45677712-45677734 CTCCAGTGCAGGTGATCCCTTGG + Intergenic
973289322 4:48454724-48454746 ATGCAGGGCAGGGTTTCTCTGGG - Intergenic
974558633 4:63487723-63487745 CTCCAGGCCAGTTTTTCCCCAGG + Intergenic
975904091 4:79188885-79188907 CCCCAGGGCAGGGTCTGACTTGG - Intergenic
976032309 4:80771062-80771084 CTCAAGGGGAGGGTTATCCTAGG + Intronic
976148664 4:82070116-82070138 CTCAAGAGCAGGGTTTTCCTTGG + Intergenic
978144483 4:105355633-105355655 CACCAGGGCACATTTTCCCTTGG + Intergenic
979881008 4:125960836-125960858 CTTGAAGGCAGGGTTTCACTGGG - Intergenic
980396980 4:132227046-132227068 CCCCAGGCTAGGTTTTCCCTGGG - Intergenic
982109284 4:152039099-152039121 CAGCAGAGCAGGGTTTCCATGGG + Intergenic
982473415 4:155821735-155821757 CTTGAAGGCAGGGTTTCTCTGGG - Intergenic
982477561 4:155872288-155872310 CTTGAAGGCAGGGTTTCACTGGG + Intronic
985199919 4:187474274-187474296 CTCTAGGGCAGGGCATGCCTGGG - Intergenic
985548942 5:523767-523789 CCCCGGGGCCGGGTTTCCTTCGG - Intronic
986274086 5:6258283-6258305 TTCCAGAGCTGGGATTCCCTGGG - Intergenic
988585992 5:32507973-32507995 CTTGAAGGCAGGGTTTCACTTGG + Intergenic
989272778 5:39552350-39552372 GTCCAGGGCAGGTTTTCACCTGG - Intergenic
990980124 5:61594824-61594846 CTCCAGGGCTCAGTTTCCTTGGG - Intergenic
992945316 5:81803691-81803713 CTCAAGGGCAGGTTTTCCCTGGG - Intergenic
993275401 5:85850509-85850531 ATGCAGGGCAGGGGGTCCCTGGG + Intergenic
994089908 5:95800709-95800731 CTCCTGCTCAGGGTTTCTCTGGG + Intronic
994718113 5:103347967-103347989 CACACAGGCAGGGTTTCCCTAGG - Intergenic
995606900 5:113866631-113866653 CACCAGGTCTTGGTTTCCCTCGG - Intergenic
997283630 5:132663477-132663499 CTCCTGGGCTGGGGTTCCCGAGG - Intergenic
997457319 5:134026969-134026991 GTCCAGGGCCAGGTTGCCCTTGG - Intergenic
998080869 5:139274068-139274090 CCCCGGGGCGGGGTTCCCCTCGG + Exonic
998558441 5:143148685-143148707 CTCCATGGCTGGGCTTGCCTAGG + Intronic
999121827 5:149215690-149215712 CGTCAGGGCAGGGTTTTCTTTGG - Intronic
999250655 5:150180402-150180424 TTCCTGGGCAGCTTTTCCCTGGG - Intronic
1000038329 5:157465976-157465998 CTCCACTGCAGGGTCTCCCTCGG - Intronic
1000171544 5:158707586-158707608 CTCCAGTGCAGGGTCTCTCCCGG - Intronic
1001494038 5:172175449-172175471 CTGCAGTGCAGGGTGTCTCTGGG - Intronic
1001670889 5:173473019-173473041 CAACAGGGCAGGGTGTCCTTGGG - Intergenic
1002377277 5:178797401-178797423 CACCCGGTAAGGGTTTCCCTGGG - Intergenic
1002593065 5:180304466-180304488 CCCTGGGGCAGGGTTTCCCCAGG - Intronic
1002602264 5:180360774-180360796 CTCCAGGGCTGGCTCCCCCTGGG - Intergenic
1003042664 6:2702278-2702300 CTCCAGAGCTTGGTTTGCCTTGG - Intronic
1003187104 6:3841401-3841423 CTCCAGGGCGGTGGTTCCCTGGG + Intergenic
1004440066 6:15641685-15641707 CTCAAGGGCAGAGAATCCCTGGG - Intronic
1006380225 6:33692981-33693003 CTCCGGGCCAGGGTTCCCCAGGG - Intronic
1012665617 6:101964692-101964714 CCCCAGGCCAGAATTTCCCTGGG - Intronic
1013479860 6:110544172-110544194 CTGCTGGGCAGGGTGGCCCTGGG - Intergenic
1014933015 6:127356277-127356299 GCCAAGGGCAGGCTTTCCCTGGG - Intergenic
1016986587 6:149900133-149900155 CTCCATGGCTGGTTTTCCCAGGG + Intergenic
1018186973 6:161273831-161273853 CTCCTGGGCTGGATTTCCTTAGG - Intronic
1018895422 6:168013250-168013272 CTCAAGGGCAGGGTTGCTGTGGG + Intronic
1018901959 6:168056168-168056190 CACCAGGGTAGGGTCTCCCCAGG - Exonic
1019161985 6:170075188-170075210 CTCCCGGGCCGCGTTTCCATGGG - Intergenic
1019308527 7:347736-347758 CCACAGGGCAGGGTTTTCCATGG - Intergenic
1020279492 7:6643105-6643127 AACCTGGGCAGGGTTTCCCCCGG + Intronic
1022275852 7:28854527-28854549 CCTCAGGGCATGGTTTCCCTCGG + Intergenic
1024882996 7:54111014-54111036 CCCCAGGCCAAGGGTTCCCTGGG - Intergenic
1024972474 7:55083367-55083389 CTCCAGTAAAGGGTTTCCCTGGG + Intronic
1026151783 7:67794086-67794108 CTCAAAGGCAGGATTTCCCCGGG - Intergenic
1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG + Intronic
1027029137 7:74875286-74875308 TCCCAGGGCAGGGTCTGCCTTGG - Intergenic
1027402344 7:77822119-77822141 CTCAAGGGCAGGTTTGCCTTAGG + Intronic
1031875839 7:127140007-127140029 CTCCAGGGCAGCATATGCCTAGG + Intronic
1033554517 7:142477130-142477152 CTCCAGAGCAGGGATTCTCGGGG - Intergenic
1034412960 7:150950741-150950763 CTCCAGGGAAGGGGTTCCAAGGG + Intronic
1035662808 8:1360260-1360282 CTCCGGGGCGGGGCTTCTCTGGG + Intergenic
1035746596 8:1965824-1965846 CTCCAGGTCTGTGGTTCCCTAGG + Intergenic
1035835761 8:2750079-2750101 CTCCAGGGTGGGGTTTCGGTAGG - Intergenic
1036586386 8:10127937-10127959 CACCAGGGCAGTGTTTCTCCTGG + Intronic
1036696314 8:10977320-10977342 CCAGAGGGCAGGGTGTCCCTGGG - Intronic
1036702453 8:11022089-11022111 CTCCAGGGCAGGGGCTTCTTTGG - Intronic
1036737634 8:11331930-11331952 CACCAGGGCAGGGTGGGCCTTGG - Exonic
1036999907 8:13705664-13705686 CCCCAGGTCCAGGTTTCCCTGGG + Intergenic
1037475885 8:19257291-19257313 CCTGAGGGCAGGGTTTCCATAGG + Intergenic
1037503309 8:19505886-19505908 CCCCACGGAAGGGCTTCCCTGGG + Exonic
1038535939 8:28352787-28352809 CTCCAGGAAAGGGGTTCTCTGGG + Intronic
1038567410 8:28631472-28631494 CTACAGGGCAGAGGATCCCTTGG + Intronic
1039895220 8:41712362-41712384 GTCCAGGGCAGGCCTACCCTTGG - Intronic
1044470657 8:92562733-92562755 TTCCAGGTCATGGCTTCCCTTGG + Intergenic
1045674013 8:104588732-104588754 CTCCAGGACGGGGGTTCCCCTGG - Intronic
1048433288 8:134390574-134390596 CTCAAGGGCAGATTCTCCCTGGG - Intergenic
1048687502 8:136920145-136920167 CTTCAGGGTAGGGTTTCACCAGG + Intergenic
1048691109 8:136964416-136964438 CTCCAGAGAAGTGGTTCCCTAGG - Intergenic
1049424808 8:142533230-142533252 GTTCAGGGCAGGGTGTCCCTGGG + Intronic
1049694100 8:143975275-143975297 TTCCAGGGCAGTGTGTCCCCAGG + Intronic
1051966573 9:22835852-22835874 TTTCAGGGCAGAGTTCCCCTTGG + Intergenic
1053002725 9:34586150-34586172 GTCCAGGGCAGGGTCTCCACGGG + Intronic
1055158091 9:73089466-73089488 ATCCAGGGCCGGGTATCCCAGGG - Intergenic
1057840351 9:98481176-98481198 CTCCAGGGCTGGCTTTCCTGTGG + Intronic
1058011519 9:99982908-99982930 CTCCAGGGCAGGGTTGCCACAGG + Intronic
1058988097 9:110228205-110228227 CTCCAGGGCAGGGATATCATTGG - Intergenic
1059681652 9:116591417-116591439 CTCCATGGCTGGCTTGCCCTTGG + Intronic
1061201734 9:129142009-129142031 CTCCAGCACAGGGATTCACTTGG - Intronic
1061424057 9:130488371-130488393 CTGCAGGGCAGGCTTGCCCAAGG + Intronic
1061741790 9:132712024-132712046 CTCCAGGAGAGGCTGTCCCTAGG - Intergenic
1061986127 9:134131326-134131348 CTCCAGGCCAGGGTGTCCCCGGG - Intergenic
1062029489 9:134355824-134355846 CTCCAGGGCAGGGTGAGCCCAGG - Intronic
1062047529 9:134431410-134431432 CCCCAGGGCCTGGTGTCCCTGGG - Intronic
1062190938 9:135247545-135247567 CTGCAGGACTGGGTTTCTCTGGG + Intergenic
1062268322 9:135697460-135697482 CTCCAGGGCTGGGTGACCCTGGG - Intronic
1203473898 Un_GL000220v1:134443-134465 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic
1203362686 Un_KI270442v1:231303-231325 CGCCAGGGCGGAGGTTCCCTAGG + Intergenic
1185694469 X:2184947-2184969 CTCAAGGGCAGAATTTTCCTTGG - Intergenic
1186914889 X:14208387-14208409 CTCAAGGGCTGAGGTTCCCTGGG + Intergenic
1187098604 X:16170196-16170218 CTCCAGGGCAGCCTGTCCCCTGG - Intronic
1187270605 X:17776334-17776356 GTCCAGGACAGGGTGCCCCTTGG + Intergenic
1187319902 X:18229391-18229413 GTCCAGGACAGGGTGCCCCTTGG - Intergenic
1189223698 X:39395196-39395218 TTCCAGGGCAGCCTTTCCCAAGG + Intergenic
1192035234 X:67555802-67555824 CCCCGTGGCAGGATTTCCCTGGG + Intronic
1192200941 X:69066365-69066387 AACCTGGGCAGGATTTCCCTCGG + Intergenic
1192510964 X:71720090-71720112 CTCCAGGGCCAGGCTTTCCTTGG - Intergenic
1192515733 X:71761463-71761485 CTCCAGGGCCAGGCTTTCCTTGG + Intergenic
1192523552 X:71822985-71823007 CTCCAGGGCCAGGCTTTCCTTGG - Intergenic
1193699916 X:84747897-84747919 CTTGAAGGCAGGGTTTTCCTGGG - Intergenic
1199091775 X:143701651-143701673 ATACAGGGCAGTGTTACCCTAGG - Intergenic
1201075560 Y:10184907-10184929 CGCCAGGGCGGAGGTTCCCTAGG - Intergenic