ID: 946183746 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:217965075-217965097 |
Sequence | AATCCATTGGAACAGGTTAA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 131 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 12, 4: 118} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946183741_946183746 | 1 | Left | 946183741 | 2:217965051-217965073 | CCAGCAGGTGGCTGCAGGCAGAG | 0: 1 1: 0 2: 6 3: 62 4: 453 |
||
Right | 946183746 | 2:217965075-217965097 | AATCCATTGGAACAGGTTAAGGG | 0: 1 1: 0 2: 0 3: 12 4: 118 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946183746 | Original CRISPR | AATCCATTGGAACAGGTTAA GGG | Intronic | ||