ID: 946183746

View in Genome Browser
Species Human (GRCh38)
Location 2:217965075-217965097
Sequence AATCCATTGGAACAGGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946183741_946183746 1 Left 946183741 2:217965051-217965073 CCAGCAGGTGGCTGCAGGCAGAG 0: 1
1: 0
2: 6
3: 62
4: 453
Right 946183746 2:217965075-217965097 AATCCATTGGAACAGGTTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946183746 Original CRISPR AATCCATTGGAACAGGTTAA GGG Intronic