ID: 946183746

View in Genome Browser
Species Human (GRCh38)
Location 2:217965075-217965097
Sequence AATCCATTGGAACAGGTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946183741_946183746 1 Left 946183741 2:217965051-217965073 CCAGCAGGTGGCTGCAGGCAGAG 0: 1
1: 0
2: 6
3: 62
4: 453
Right 946183746 2:217965075-217965097 AATCCATTGGAACAGGTTAAGGG 0: 1
1: 0
2: 0
3: 12
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946183746 Original CRISPR AATCCATTGGAACAGGTTAA GGG Intronic
901597189 1:10395089-10395111 AAGACATTGTAACATGTTAACGG - Intergenic
904147235 1:28402971-28402993 AGTCCCTTGGAACATGTGAAAGG + Intronic
908887770 1:68809949-68809971 TATCCAAAGGAAAAGGTTAATGG - Intergenic
908891032 1:68848141-68848163 AATCCTCTGAAAGAGGTTAATGG + Intergenic
915742493 1:158129660-158129682 AATCCATTGGATGAGTTCAATGG - Intergenic
916004686 1:160648830-160648852 AGTCCATTGTAACAGGTCATAGG + Intergenic
916249371 1:162722454-162722476 AATCCAGTGGGAGAGGTTATTGG + Intronic
916513246 1:165492169-165492191 AATCCATTCTAACATGTTAGAGG - Intergenic
918389256 1:184040824-184040846 AATCAATTGGAACAGTCTACTGG - Intergenic
919617376 1:199824439-199824461 AGACCAATGGAACAGGTTAGAGG + Intergenic
919712365 1:200739952-200739974 AAGCCTTTGGGACAGGTTAGTGG + Exonic
923266133 1:232315972-232315994 AATACTTAGGAATAGGTTAATGG + Intergenic
923816631 1:237386873-237386895 AATCTATTGGACCAAGTTTATGG - Intronic
1068662253 10:59634686-59634708 AAGCCATTGTAACATCTTAAGGG + Intergenic
1068925938 10:62538416-62538438 AATGCCTTGAAACAGGTCAATGG + Intronic
1071767600 10:88686338-88686360 GATACATTGGAAATGGTTAATGG - Intergenic
1072357313 10:94624295-94624317 GATCCATGGGTAGAGGTTAACGG + Intergenic
1075081171 10:119384891-119384913 AAACAACTGGAGCAGGTTAAAGG + Intronic
1079858707 11:25639991-25640013 AATTCAATGCAACAGGTGAATGG + Intergenic
1086342406 11:85859477-85859499 AAACTAATGGAACAGGTTAAAGG + Intronic
1087045843 11:93843235-93843257 AATCCCTAGCACCAGGTTAAGGG + Intronic
1087434548 11:98097430-98097452 TATCCTTTGGAAGAGGTTAATGG + Intergenic
1087532128 11:99396810-99396832 AATCCATTTGAAAGTGTTAAAGG - Intronic
1087618786 11:100519112-100519134 GATACATTGGAACTGGGTAATGG - Intergenic
1088460510 11:110077461-110077483 AGTTCATTGGTAAAGGTTAAGGG + Intergenic
1091709548 12:2728903-2728925 AGACCATTGGAACAGGATAGGGG - Intergenic
1094044196 12:26149122-26149144 AATCTATTGCATCAGGTAAAGGG - Intronic
1099854437 12:88145622-88145644 AATCCATTGGAAGAGAAAAAGGG + Intronic
1101052625 12:100879202-100879224 AAGCCATTGGAACATGTTTGTGG + Intronic
1103811229 12:123615486-123615508 AAGCAATTGGAACAGGGCAATGG - Intronic
1107276436 13:38685814-38685836 AATCCCTTGGAGCAGGAAAAGGG + Intergenic
1107358834 13:39597867-39597889 AGTACTTTGGAACAAGTTAAAGG - Intronic
1107646407 13:42498602-42498624 AAGCCATTGTAATAGGATAATGG - Intergenic
1108239236 13:48444833-48444855 CCTGCCTTGGAACAGGTTAAAGG + Intronic
1108906177 13:55477198-55477220 AATCCATTGCAACAGGAGAAAGG - Intergenic
1109677082 13:65691366-65691388 AATACATTTAAACAGGCTAATGG - Intergenic
1111568160 13:90043801-90043823 AATCCTTTGGAAAAGAGTAAAGG + Intergenic
1113549436 13:111181022-111181044 AATAAATTGGAGCAGGTGAATGG + Intronic
1114300706 14:21374525-21374547 AATCCATAGAGACAGGTTAGTGG - Intronic
1115514412 14:34171068-34171090 ACTCACTGGGAACAGGTTAATGG + Intronic
1116929702 14:50677830-50677852 AAGCCATTGAAACAGGATGAAGG + Intergenic
1118119106 14:62818065-62818087 AACCCATAGAAACAGGGTAAAGG + Intronic
1119822291 14:77627771-77627793 AAACAATTTAAACAGGTTAAAGG + Intergenic
1120809029 14:88783383-88783405 GATCCAATGGAACAGATCAATGG + Intronic
1121746160 14:96295023-96295045 AATTCAGTGGAAGTGGTTAATGG - Exonic
1125071561 15:35560651-35560673 AATCCATTGGCAGAGATTATGGG - Intergenic
1126975227 15:54170610-54170632 ATTTCATTTGAACAGGTTAAAGG + Intronic
1128253581 15:66180657-66180679 AATCCATTGTAACACTTTAGGGG + Intronic
1128301382 15:66568159-66568181 AAGGCATTGGAACAGGTGGAAGG + Intergenic
1128915575 15:71558373-71558395 AATACATTAGAACAGATTAAAGG - Intronic
1130810719 15:87375450-87375472 AGACCAATGGAACAGGTTAGAGG + Intergenic
1131774024 15:95774530-95774552 AATACTCTGGAACAGGATAATGG - Intergenic
1136732996 16:32435636-32435658 AATCCACTGGTACACGATAAAGG + Intergenic
1139543564 16:67636944-67636966 AAGCCATGAGAACAAGTTAAGGG + Intronic
1140114449 16:72029418-72029440 AGTCCATTGAAACTGGTTTATGG + Intergenic
1203020085 16_KI270728v1_random:393967-393989 AATCCACTGGTACACGATAAAGG - Intergenic
1203038420 16_KI270728v1_random:667125-667147 AATCCACTGGTACACGATAAAGG - Intergenic
1146144152 17:30396623-30396645 AATCGATTGAAAGAGTTTAATGG + Intronic
1156024888 18:32641306-32641328 AAACCAGTGGAACAGAATAAAGG - Intergenic
1158790917 18:60779599-60779621 ATACCAATGGAACAGGTTAGAGG + Intergenic
926762837 2:16294572-16294594 AATTAATGGGAACATGTTAATGG - Intergenic
927401983 2:22722088-22722110 GAGACATTGGAACAGGTTAAAGG - Intergenic
930092466 2:47541153-47541175 AATCAATTGGAAAAGGGTGAGGG - Intronic
931522213 2:63111365-63111387 AATCCATTGTAAGAGGATAAAGG + Intergenic
932717837 2:74115650-74115672 GATTCAATGGAACATGTTAAAGG + Intergenic
933357938 2:81237551-81237573 TATCCATTGGTACAGGGGAATGG + Intergenic
939018133 2:136925713-136925735 AATTCTTTGGAAGAGTTTAAGGG + Intronic
939739815 2:145892708-145892730 AATGCATTGTAACAGGTATAGGG + Intergenic
941146171 2:161848715-161848737 AGACCAATGGAACAGGTTAAAGG - Intronic
941757565 2:169204008-169204030 AATCCTTGTGAACAGTTTAATGG - Exonic
943405048 2:187472103-187472125 AAACCATTGGTAGTGGTTAAAGG - Intronic
946183746 2:217965075-217965097 AATCCATTGGAACAGGTTAAGGG + Intronic
1173680995 20:44881756-44881778 AATCCTTAAGAATAGGTTAATGG + Intergenic
955647762 3:61158615-61158637 AATGCAATGGAAAAGGTAAAAGG - Intronic
957192234 3:77024251-77024273 AATCCATTGGAAGAGGACACAGG + Intronic
962613933 3:137105189-137105211 AGTCCATGGGAACTGGATAACGG + Intergenic
963393323 3:144697739-144697761 AGACCAATGGAACAGGTTAGAGG - Intergenic
963703477 3:148655959-148655981 AGACCAATGGAACAGGTTAGAGG - Intergenic
963871732 3:150423076-150423098 GTTCCATTTGAACACGTTAAAGG + Exonic
964394837 3:156234448-156234470 CATCCATAGGAATAGGTGAAAGG + Intronic
964615250 3:158656854-158656876 AAAACATTGGAAGATGTTAAAGG - Intronic
965359546 3:167721593-167721615 TTTCCAATGGAACAGGTTATTGG - Intronic
969294594 4:6262507-6262529 TATCCATTGGAACAGGTGTGGGG + Intergenic
971673739 4:29596663-29596685 AATCCATTTCTCCAGGTTAAGGG + Intergenic
972843503 4:42959389-42959411 AATACATAGGAACAGTTGAATGG + Intronic
973135868 4:46706041-46706063 AGCCCATTGGAAAAGGTCAAAGG + Intergenic
977211312 4:94221548-94221570 AATGTATTGCAACAGATTAAAGG + Intronic
986902639 5:12455497-12455519 AATGCATAGGATAAGGTTAATGG - Intergenic
992264720 5:75007135-75007157 ACTCCATGGGCACAGGTTTAGGG + Intergenic
992898434 5:81268812-81268834 AGTCCATTGGAAGAGATAAAGGG + Intergenic
993310683 5:86328348-86328370 AATCCATTCAACCAAGTTAATGG + Intergenic
998649841 5:144106266-144106288 AATCTTGTGGAACAGATTAAAGG - Intergenic
1002352760 5:178594904-178594926 AATACATTGGATCACATTAAAGG + Intergenic
1005198846 6:23319964-23319986 AATCCATTGTAACAGGACACAGG + Intergenic
1008365930 6:50680111-50680133 TATACATTGAAACAGGATAAAGG - Intergenic
1010350942 6:74873496-74873518 AATGCATTGGAACAGGGCTAAGG + Intergenic
1011612331 6:89165884-89165906 AATGCAATGGAACAGGTTTTTGG + Intergenic
1014402876 6:121012921-121012943 TAACCATTGGAACATGTCAAAGG + Intergenic
1014631677 6:123797079-123797101 AAGCCATTGGTACAGGCTGAGGG - Intergenic
1018589628 6:165405042-165405064 AATCCACTGAAACACGTTAGAGG - Intronic
1020509928 7:9041951-9041973 AATCCATTGAAACAGAATATTGG - Intergenic
1021064041 7:16150388-16150410 TATGCATTGGAAGATGTTAAAGG + Intronic
1022724266 7:32966479-32966501 AAGCAAATGGAACAGGTGAAGGG - Intronic
1024616059 7:51113033-51113055 AATCCTTTGGCACAGGTCTAGGG + Intronic
1025049344 7:55721356-55721378 AAGCAAATGGAACAGGTGAAGGG + Intergenic
1026448116 7:70503228-70503250 AATCCATTGTCACATGTTAATGG + Intronic
1027763243 7:82306516-82306538 TATCCATTGTCACAGATTAATGG + Intronic
1029691665 7:102186253-102186275 CATCCATGGGACCAGGTTACAGG + Intronic
1029924539 7:104301891-104301913 AACCCATTGGAAGAGGTTTAAGG + Intergenic
1031334827 7:120515419-120515441 AATACATGTGAAAAGGTTAAAGG + Intronic
1031988003 7:128176020-128176042 AAACCATTGGCACAGGATAGGGG + Intergenic
1035791622 8:2311444-2311466 AATCCACTGGAAATGGATAAAGG + Intergenic
1035801183 8:2410261-2410283 AATCCACTGGAAATGGATAAAGG - Intergenic
1040845749 8:51837288-51837310 AATCAATTTAAACATGTTAAAGG - Intronic
1042348398 8:67750862-67750884 AATGGATTGGAACAGCTTCATGG - Intergenic
1043747582 8:83895159-83895181 AATCCATTGGTATATGATAAAGG + Intergenic
1044913794 8:97090494-97090516 AATGAATTAGCACAGGTTAAAGG - Intronic
1046477135 8:114760219-114760241 AATCCAAAGCAACAGGTCAAGGG + Intergenic
1048380433 8:133860531-133860553 AAACCTTTGGACCAGGTTGATGG - Intergenic
1055745338 9:79438082-79438104 AATCCCTTGGAACAGATCAAAGG - Intergenic
1058184807 9:101841708-101841730 AATCCAATGGTTCAGGTCAAAGG + Intergenic
1060125728 9:121043051-121043073 AATCCATTGTCATAGGTTATTGG + Exonic
1186064127 X:5743133-5743155 AATCCATTGGCACAAATTAGTGG - Intergenic
1186613652 X:11163902-11163924 GCTCCATGGCAACAGGTTAAAGG + Intronic
1192866318 X:75136693-75136715 TGACCATTGGAACAGGTTAGAGG + Intronic
1196411118 X:115419895-115419917 AATCCATTCGAACACTTAAAGGG + Intergenic
1197489598 X:127101039-127101061 AATCAGTAGGAACAGGTTCAGGG - Intergenic
1198136842 X:133761156-133761178 AAACCACTGGAAAAGGTTAATGG + Intronic
1198309755 X:135419340-135419362 TAACCAGTGGAACTGGTTAAAGG + Intergenic
1201618222 Y:15925432-15925454 AATCCATTCAAACAGATTATAGG - Intergenic
1202016764 Y:20416167-20416189 AGACCATTTGAACAGATTAAAGG - Intergenic