ID: 946184787

View in Genome Browser
Species Human (GRCh38)
Location 2:217974378-217974400
Sequence CTGAGGGGATGGAGGAAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 644
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 592}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946184787_946184792 -7 Left 946184787 2:217974378-217974400 CCTGCTTTCCTCCATCCCCTCAG 0: 1
1: 0
2: 6
3: 45
4: 592
Right 946184792 2:217974394-217974416 CCCTCAGCCTCTCCCCAGAAAGG 0: 1
1: 0
2: 1
3: 56
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946184787 Original CRISPR CTGAGGGGATGGAGGAAAGC AGG (reversed) Intronic
900003525 1:29232-29254 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900023245 1:199748-199770 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
900071153 1:772195-772217 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
900265557 1:1755531-1755553 CTGAGGTGCTGCTGGAAAGCTGG - Intronic
901191992 1:7418092-7418114 CCAAGGGGTAGGAGGAAAGCTGG - Intronic
901453811 1:9352076-9352098 GTGAGGGGGTGGAGGGAAGGTGG + Intronic
902053405 1:13581720-13581742 CTGAGGGGAAGAGGGAAAGAAGG - Intergenic
902363910 1:15958570-15958592 CTGAGGGGATGGTGGAGTGGAGG + Intronic
903136585 1:21313358-21313380 CTGGGGGGATGGAGGGAGCCCGG + Intronic
903149680 1:21397973-21397995 CTCAGGAGAGGGAGGAAAGGAGG - Intergenic
904229744 1:29058670-29058692 CTGAGGGGGTGGAGGGAAAGAGG - Intronic
904591777 1:31619028-31619050 CTGAAGGGAGGAAGGAAAGGAGG - Exonic
905060177 1:35133390-35133412 CTGAGGTGAAGGAGAAAAACTGG + Intergenic
905284217 1:36868820-36868842 CTGAGGGTCTGGTGGAAGGCGGG - Intronic
905488746 1:38327213-38327235 CTGAGGCCTTGGAGGCAAGCAGG + Intergenic
905932274 1:41797458-41797480 CTGAGAGGAGGGAGGAAAGACGG + Intronic
906457044 1:46006063-46006085 CTGAAGGGCTGGAGAAAAACAGG + Intronic
906626996 1:47333717-47333739 CCCAAGGGTTGGAGGAAAGCTGG + Intergenic
907380423 1:54082710-54082732 GTGAGGGGAGGGAGGAAGGAGGG + Intronic
907425361 1:54375935-54375957 GGGAGGGGAAGGAGGAGAGCAGG + Intronic
907459746 1:54598371-54598393 TTGAGGGGACAGAAGAAAGCAGG - Intronic
908267473 1:62393586-62393608 CAGAGGGGTTGGAGCAATGCAGG - Intergenic
908485289 1:64585978-64586000 CTGAGGGGTTGGAACAAAGGTGG - Intronic
908741020 1:67327704-67327726 AGGAGGAGATGGAGGAAAGGAGG + Intronic
909431609 1:75593842-75593864 GTCAGGGGATGGAGGGAAGAGGG + Intronic
909601687 1:77467763-77467785 CTCAGGGGAAGGAGGAGAGGAGG + Intronic
910490227 1:87761140-87761162 CTGTGTGCATGGGGGAAAGCAGG - Intergenic
910603387 1:89055594-89055616 CTGTGGGGATGGGGGAACACTGG + Intronic
910637328 1:89423520-89423542 CTGTGGGGATGGGGGAACACTGG - Intergenic
911307712 1:96251193-96251215 CTAATGGGATGGATGATAGCAGG + Intergenic
911470561 1:98313007-98313029 CAAAAGGGATGGAGGAAAGTGGG + Intergenic
911800160 1:102126316-102126338 CTGAAGGGAAGGAGGAAATGTGG + Intergenic
912504286 1:110145230-110145252 TTGAGTGGATGGGGGATAGCTGG + Intergenic
912506180 1:110157975-110157997 ATGAGGGGATGGAGCACAGCAGG - Intronic
912635799 1:111291508-111291530 CTGAGGGGTTGGGGGCAAGGGGG + Intronic
913193370 1:116432408-116432430 CTGAGGAGAGGGATGAAAGCAGG - Intergenic
913706516 1:121429716-121429738 CTGAGAGAATGGAGCAGAGCAGG - Intergenic
915035247 1:152918184-152918206 CTGATGGCATAGAAGAAAGCTGG + Intergenic
915148055 1:153807166-153807188 CTCTGGGGATGGAGGAAGCCAGG + Exonic
915282821 1:154834272-154834294 CTGAGAGCCTGGAGGAAGGCTGG + Intronic
915454544 1:156030875-156030897 CTGAGGGGTGGGAGGGATGCAGG - Intergenic
915916086 1:159941828-159941850 CTGTGGGAATGGATGAAAGCGGG - Intronic
916278158 1:163018077-163018099 CTTATGGGATGTAAGAAAGCAGG - Intergenic
916779534 1:168009514-168009536 AAGAAGGGATGGAGGAAAGAAGG - Intronic
917109366 1:171529401-171529423 CTGTGGGTATGCAGGAAAGGTGG - Intronic
917672488 1:177286106-177286128 GTGTGGGGATGGAGGAGAGAAGG + Intergenic
918092213 1:181307369-181307391 CTGATAGGAAGGAGGTAAGCTGG + Intergenic
919360095 1:196581617-196581639 CTAAGGAGATGGGGGAAAGATGG + Intronic
920344773 1:205299116-205299138 TGGAGGGGATGGAGGAGAGGAGG - Intergenic
920363566 1:205436110-205436132 CTGAGGGGCGGGAGGAAGGCAGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
921112655 1:212054245-212054267 GTGAGGGGATGGGGAAAACCTGG - Intronic
921177237 1:212606205-212606227 CTGAGGGGAGGGAGGCAGGCAGG + Intronic
921422635 1:214966141-214966163 CTTAGGGGTTGGAGGGAAGGTGG + Intergenic
922106512 1:222517644-222517666 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
922910688 1:229213697-229213719 CTGTGGGCAAGGAGGAAAGAAGG + Intergenic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924348698 1:243095210-243095232 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
924444815 1:244119367-244119389 GAGAGGAGATGGAGGAAAGGAGG + Intergenic
1063157240 10:3391013-3391035 ATGTGGGGATGGAGGAATGGGGG + Intergenic
1063689052 10:8266267-8266289 CGGAGGGGATGGAGAGAAGAGGG + Intergenic
1063922349 10:10945314-10945336 ATCATGGGAGGGAGGAAAGCAGG + Intergenic
1064106376 10:12503983-12504005 CTCAGTGGATGCGGGAAAGCAGG - Intronic
1064267625 10:13837739-13837761 GGGATTGGATGGAGGAAAGCTGG - Intronic
1065139135 10:22703562-22703584 ATGAGGGCAAGGAGGAAAGTGGG + Intronic
1066412569 10:35187856-35187878 CTGAGAGAATGGAGAAAACCAGG + Intronic
1067575157 10:47404171-47404193 CTGGGGAGCTGGAGGAAGGCAGG + Intergenic
1067694753 10:48526722-48526744 CTGAGAGGAAGTAGCAAAGCAGG + Intronic
1068013654 10:51486243-51486265 GTCAGGGGATGGGGGAAAGGGGG - Intronic
1068738219 10:60438848-60438870 CTGTGGGGAGGGAGAAAAGCAGG + Intronic
1070169858 10:73924833-73924855 TGGAGGGGATGAAGGAAACCAGG - Intergenic
1070609087 10:77921285-77921307 CAGAGGGGATGAAGAAAAGGTGG + Intronic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071515240 10:86292606-86292628 CTGAAGAGAGGGAGGAAGGCAGG - Intronic
1071534707 10:86418530-86418552 CGGAGGGGAGGAAGGAAAGAAGG + Intergenic
1072038574 10:91586553-91586575 CTGAGTGGATGGATGAAGTCTGG - Intergenic
1072805070 10:98418948-98418970 CTGAGGGCACGGAGGAAAGCTGG + Intronic
1072975523 10:100054205-100054227 TGGGGGGGATGGAGGAAAGAAGG - Intronic
1073511875 10:104047534-104047556 CTGAGCTGCTGGAGGAAAACGGG + Intronic
1073692943 10:105831613-105831635 GTGAGGGGAAGGAAGAAAGAAGG + Intergenic
1074078524 10:110150539-110150561 CTGAGGGGAAGGCGGACAGCTGG - Intergenic
1074210699 10:111331537-111331559 CTGAGGAGATGGAGGGAGACAGG - Intergenic
1074449497 10:113547702-113547724 CATGGGGGAGGGAGGAAAGCAGG - Intergenic
1074740102 10:116478293-116478315 CTGGGGAGAAGGAGGAAAGCAGG + Intergenic
1074963102 10:118465441-118465463 CTGAGGGGAAAGAGAAAAGCTGG - Intergenic
1075294618 10:121263329-121263351 ATGAGGCAATGGAGGAAGGCTGG - Intergenic
1075658049 10:124174721-124174743 CTGAGGGGAGGCTGGACAGCAGG - Intergenic
1076710565 10:132331737-132331759 CAGAGGGGAAGGAAGAGAGCGGG - Intronic
1076975266 11:166972-166994 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1077020984 11:417107-417129 CTGGGGGAAGGGAGGAAAGTGGG - Intronic
1077310306 11:1885766-1885788 CTGATTGGATGGAGGAATACTGG - Intronic
1077433258 11:2526432-2526454 CTGTGGGGAGGGAGGAACCCAGG + Intronic
1077556792 11:3229911-3229933 GGGAGGGGATGGAGGGAGGCTGG - Intronic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077846475 11:6030503-6030525 GGGAGGGGAGGAAGGAAAGCAGG + Intergenic
1077948176 11:6925801-6925823 CTGAGAGGTAGGAGGAAATCTGG - Intergenic
1078523829 11:12085662-12085684 CGGAGGAGGTGGAGGAAATCGGG - Intergenic
1078967999 11:16370029-16370051 CTGAGAGGATGGTGGCCAGCTGG - Intronic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1079942920 11:26704383-26704405 CTGAGGGAATACAAGAAAGCTGG + Intronic
1080336445 11:31202906-31202928 CTGAGGGGATGGATGGAGGGTGG + Intronic
1080476316 11:32595177-32595199 CTCAGTGGATGAAGAAAAGCTGG - Intronic
1080693985 11:34584833-34584855 CTTAGGGGTTGGAGAAAACCAGG + Intergenic
1081501381 11:43669996-43670018 CTTAAGGGAGGGAGGGAAGCTGG + Intronic
1081646205 11:44792407-44792429 CTGAGTGGAAGGAGGTGAGCGGG + Intronic
1081803502 11:45876076-45876098 CAGAGGAAATGGAGGAAAGAGGG - Intronic
1082824402 11:57567509-57567531 CGGAGGGGATGGAGGGAGGAGGG + Intronic
1083269643 11:61565346-61565368 TTGAGGGGAGGGAGGGAAGCAGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083861626 11:65423124-65423146 CTGTGTGGAAGGAGGAAGGCAGG + Intergenic
1083913027 11:65720976-65720998 GAGAGGGGAGGGAGGAAAGAGGG - Intergenic
1084134603 11:67167347-67167369 CTGATGGTATGCAGGAAGGCAGG + Intronic
1084495624 11:69501500-69501522 ATGGGTGGATGGAGGAAAGGAGG + Intergenic
1084975952 11:72798473-72798495 ATGAGGGGGTGGAGCAAATCGGG - Intergenic
1085021491 11:73213008-73213030 CTGTGGGCATGGAGGAAAGCTGG + Intergenic
1085301906 11:75463541-75463563 ATAAGGGGACGGATGAAAGCAGG - Intronic
1088782099 11:113145760-113145782 CTCAGGGGGTGGAGGAAAGTGGG - Intronic
1089016920 11:115172909-115172931 CTGAGGGGATGGTGGGAAAAGGG + Exonic
1089621736 11:119726599-119726621 CTGAGTGGGTGGAGCACAGCAGG + Intronic
1089758211 11:120702620-120702642 CCAAGGGGCAGGAGGAAAGCTGG + Intronic
1089780911 11:120872679-120872701 CTGAGGGGGTCCAGGAAGGCAGG - Intronic
1089982442 11:122783396-122783418 CAGAGAGGAGGGAGGCAAGCTGG - Intronic
1090659355 11:128870726-128870748 CTGAGGGGAGGAGGGAGAGCAGG - Intergenic
1090890059 11:130915661-130915683 CTCAGGGCATGGAGGACAGGTGG + Exonic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091376944 12:31286-31308 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1092065572 12:5587602-5587624 CGGAGGGGATGAAAGAAAACTGG - Intronic
1092255951 12:6927113-6927135 GTGGGGGGATGAAGGAATGCTGG - Intronic
1092778893 12:11967260-11967282 GCGGGGGGATGGAAGAAAGCTGG - Intergenic
1092993872 12:13929616-13929638 GTGACAGGATAGAGGAAAGCTGG - Intronic
1093073528 12:14732733-14732755 TTGAGAGGATGGAGGAAAGGAGG + Intergenic
1093427536 12:19045382-19045404 CTGAGGAGATGGAGAAAGACAGG - Intergenic
1095791234 12:46169575-46169597 CTGAGGGGAGGGAGGGAAATGGG + Intergenic
1095942269 12:47735046-47735068 TGGAGGGGAAGGAGGAAAGGAGG + Intronic
1096100853 12:48969825-48969847 CTGAGCGGAGGCAGGAAAGGGGG + Intronic
1096429716 12:51532735-51532757 CTGGGGGGTTGGAGGGAGGCAGG + Intergenic
1096717288 12:53499275-53499297 CTGTGGGGATGGAGGAACTGGGG - Intronic
1097097773 12:56563356-56563378 CAGTGGGGATGGAAGAAAGTGGG + Intronic
1098230227 12:68365517-68365539 CTGCGGAGGAGGAGGAAAGCTGG - Intergenic
1098917432 12:76272156-76272178 CTGAGGGGAGGGAGAAGAGACGG - Intergenic
1099198326 12:79646175-79646197 GGGAAGGGATGGGGGAAAGCTGG + Intronic
1100718394 12:97329455-97329477 CTGTGGGATTGGAGGAAAGGTGG + Intergenic
1101240651 12:102834847-102834869 CTGAGAGGTTGGAGGAATGGAGG + Intergenic
1101251484 12:102939947-102939969 CTGAGAGGATGGAGGCAAGCAGG + Intronic
1101382425 12:104225789-104225811 ATGAAGGGATGGAGGAATCCAGG - Intronic
1101588731 12:106108076-106108098 ATGAAGGGAAGGAGGAAAGGAGG + Intronic
1102536740 12:113587259-113587281 GGGAGGGGTTGGAGGCAAGCAGG + Intergenic
1103030165 12:117606484-117606506 AGGAGGGGATGGAGGAAGGAAGG - Intronic
1103149981 12:118628972-118628994 TTGAGGGGATGGAGGGAACATGG + Intergenic
1103562809 12:121800887-121800909 CCGGGGGGACGGAGGAAAGGAGG + Intronic
1103624121 12:122205695-122205717 AAGAGGGGAAGCAGGAAAGCTGG - Intronic
1104368510 12:128199966-128199988 CAGAGAGGAAGGAGGAAAGAAGG - Intergenic
1104678129 12:130729525-130729547 CAGAGTGGATGCAGGACAGCAGG + Intergenic
1104854860 12:131896751-131896773 AGGAAGGGAGGGAGGAAAGCAGG - Intronic
1105332579 13:19431935-19431957 CTCAGGGGAGGCGGGAAAGCAGG - Intronic
1105580481 13:21691368-21691390 CAGAGGAGATGGAGAAAAACAGG + Intronic
1105879107 13:24587842-24587864 CTCAGGGGAGGCGGGAAAGCAGG + Intergenic
1105920731 13:24961210-24961232 CTCAGGGGAGGCGGGAAAGCAGG - Intergenic
1106578578 13:30998870-30998892 CTGTGGGCAGGGAGGAGAGCAGG + Intergenic
1107838181 13:44429062-44429084 CTGATGGGATGGAGAAGACCCGG - Intergenic
1108209174 13:48121063-48121085 TTGAGGGGATGAGGGAAAGTGGG - Intergenic
1109594297 13:64530057-64530079 CTGGGGGGTGGGAGGAAAACAGG - Intergenic
1112158540 13:96844750-96844772 CTGTAGGGATGGAGACAAGCAGG - Intergenic
1112184176 13:97112269-97112291 GTGAGGGGATGGAGGAGCCCAGG - Intergenic
1112651401 13:101402813-101402835 ATGAGAGGAAGGAGAAAAGCAGG - Intronic
1113040740 13:106101495-106101517 CTGAGGGACTGAAGGAAAGAAGG - Intergenic
1113600276 13:111563450-111563472 GTGAGGGGAGGGAGGGAAACAGG - Intergenic
1113808600 13:113123922-113123944 CTGAGGGGGAGGAAGAAGGCTGG - Intronic
1113808894 13:113125740-113125762 TTGAGGGAATGAAGGAAAGATGG - Intronic
1114484378 14:23054369-23054391 CTGTGGGGAGGGAGGAGGGCTGG - Intronic
1114702037 14:24688470-24688492 GTGAGAAGATGGAGGACAGCAGG - Intergenic
1116238698 14:42313361-42313383 ATGAGGGGATGCAGGAGGGCAGG + Intergenic
1116292274 14:43059371-43059393 CAGAGGGGTTGGAGGGCAGCAGG + Intergenic
1117583949 14:57180952-57180974 GTGAGGGGATGGGGGAAATGGGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117877858 14:60274153-60274175 CTTAGGGGTAGGAAGAAAGCTGG + Intronic
1118845224 14:69543071-69543093 CTCAGGACAGGGAGGAAAGCTGG + Intergenic
1118909229 14:70047400-70047422 CAGAGGGGAGGGAGGAAATATGG - Intronic
1118991598 14:70801801-70801823 CTCAGGCGATGAAGGAAATCAGG + Intronic
1118994327 14:70822670-70822692 GTGAAGGGAAGGAGGAAAGGAGG - Intergenic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1123926700 15:25120004-25120026 CTGTGAGGCTGTAGGAAAGCTGG - Intergenic
1124586461 15:31014196-31014218 CTGAGGTGACGGATGACAGCTGG - Intronic
1124656914 15:31516292-31516314 GAGAGGTGATGGAGGACAGCTGG + Intronic
1125547876 15:40521082-40521104 CTGAGGAGGAGGAGGAAAACGGG + Intergenic
1125885917 15:43229401-43229423 CTCTGGGGTTGGAGGAAAGCTGG + Intergenic
1126385360 15:48088408-48088430 CTGAGGGGAATGAGGAATGGAGG - Intergenic
1126952499 15:53897071-53897093 ATGAAGTGAGGGAGGAAAGCAGG - Intergenic
1127370653 15:58335973-58335995 CTGAGGAGATGGAGAAAGACAGG - Intronic
1128473810 15:67979730-67979752 CAGAGGTGATGGAAGAAAGTTGG - Intergenic
1128573860 15:68756150-68756172 CTAAGGTGAAGGAGGAAGGCAGG + Intergenic
1128576440 15:68778973-68778995 CTGAGGGGCAGGAGAAAAACTGG + Exonic
1128752888 15:70161585-70161607 CTGAATGAATGGATGAAAGCAGG + Intergenic
1128839400 15:70837485-70837507 TTGAGGGGATGGAGTAGAGAAGG - Intronic
1129270540 15:74417211-74417233 CTGGGGCCATGCAGGAAAGCAGG - Intronic
1130063735 15:80588087-80588109 CAGTGAGAATGGAGGAAAGCAGG + Intronic
1130415253 15:83687814-83687836 TGGCGGGGATGGAGGAAAACTGG + Intronic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130898149 15:88186594-88186616 CTCTGGGGCTGCAGGAAAGCAGG - Intronic
1130978026 15:88792188-88792210 ATGAGGGGAGGGAGGCAGGCAGG + Intergenic
1131032722 15:89199943-89199965 CAGAGGGGAAGGAAGGAAGCAGG - Exonic
1131322438 15:91407442-91407464 TGGAAGGGAAGGAGGAAAGCGGG + Intergenic
1131809499 15:96158162-96158184 ATGAAGGGATCAAGGAAAGCTGG + Intergenic
1131986431 15:98046498-98046520 CCCAGGGGAGGGAGGATAGCAGG + Intergenic
1132376603 15:101332283-101332305 CTGCTGGGATGGAGGTCAGCCGG + Intronic
1132449976 15:101961708-101961730 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
1132498948 16:276187-276209 GTGAGGGGATGGAGCTCAGCTGG + Intronic
1132629257 16:908914-908936 CAGAGGGCAGAGAGGAAAGCTGG + Intronic
1132633907 16:933602-933624 CTGAGGTCATGGAGAAAGGCAGG + Intronic
1134573095 16:15308618-15308640 CTAATGGGAAGGAGCAAAGCTGG - Intergenic
1134729287 16:16447338-16447360 CTAATGGGAAGGAGCAAAGCTGG + Intergenic
1134938147 16:18264526-18264548 CTAATGGGAAGGAGCAAAGCTGG - Intergenic
1136504233 16:30692519-30692541 CTGTTGGGATGGAAGAGAGCAGG + Intergenic
1136536635 16:30903398-30903420 CAGAGGGGCTGAAGGAAAGGAGG - Exonic
1137379712 16:47986138-47986160 CTGATGGGATGGAGCCAAGGGGG + Intergenic
1139234202 16:65317470-65317492 CTGAAAGAATGAAGGAAAGCAGG - Intergenic
1139251195 16:65498158-65498180 CTGAGGAGTTGGAGGAACCCTGG + Intergenic
1139517532 16:67460653-67460675 ATGGGGGGAGGGGGGAAAGCTGG - Intronic
1140239971 16:73191811-73191833 AAGAGGGGAAGGAGAAAAGCTGG + Intergenic
1140408098 16:74724392-74724414 CTGAGGAGACGGGGGAAAGGGGG - Intronic
1141800351 16:86303879-86303901 CCAGGGGCATGGAGGAAAGCTGG + Intergenic
1141896718 16:86963146-86963168 CAGAGGGGATGGGGCAATGCTGG - Intergenic
1141944322 16:87298981-87299003 GTGAGGGGAGGAAGGAGAGCTGG + Intronic
1142144417 16:88486989-88487011 CTGTGAGGGTGGAGGAAATCAGG - Intronic
1142253999 16:89005373-89005395 CTGCGGGGAAGGAGGTGAGCTGG + Intergenic
1142462516 17:104779-104801 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1142698052 17:1644304-1644326 CTGCTGGGCTGGAGGAGAGCTGG + Intronic
1144094384 17:11886709-11886731 CTTAGGGGATGGAGTGAAGAGGG - Intronic
1144740671 17:17580539-17580561 GTGGGGGGAGGGTGGAAAGCTGG + Intronic
1145733276 17:27209912-27209934 GGGAGGGGAGGGAGGGAAGCAGG - Intergenic
1146521860 17:33531711-33531733 CGTAGAGGATGGAGGAAAGAAGG - Intronic
1146821170 17:35984524-35984546 CTGAGGGCATGGAGGAGGGAAGG + Intronic
1147460868 17:40568289-40568311 CACAGAGGATAGAGGAAAGCAGG + Intergenic
1147726579 17:42569323-42569345 TGGAGGGGATGGAGCCAAGCGGG + Intronic
1147871623 17:43591711-43591733 CTGGGGGGCTGGGGGAAACCTGG + Intergenic
1147888855 17:43702961-43702983 CTGAGGGGATGAATGTGAGCTGG + Intergenic
1148113674 17:45162169-45162191 CTGAGAGGAAGGAGGGAGGCAGG + Intronic
1148721561 17:49757181-49757203 CTGGGGGGGTGGAGGACAGATGG - Intronic
1148864217 17:50620155-50620177 CTTAGGGGGTGGAGGGAAGGAGG + Intronic
1148904111 17:50900703-50900725 CTGAGGGGAGGGAGGCGAGCTGG + Intergenic
1148996137 17:51711630-51711652 AAAAGGGGAAGGAGGAAAGCGGG + Intronic
1149116431 17:53102659-53102681 ATGAGGGGAGGTAGGACAGCAGG - Intergenic
1149334060 17:55617531-55617553 CCAAAGGGATGGAGCAAAGCCGG - Intergenic
1149734655 17:58981317-58981339 CTGAAGGGATGGTGGGAAGGGGG - Exonic
1150645736 17:66976475-66976497 TGGAGAGGATAGAGGAAAGCTGG - Intronic
1151520793 17:74627976-74627998 TTGAGGGGATGGGGCACAGCAGG - Intergenic
1151542178 17:74770182-74770204 CTGAGGGGAATGAGTAAAGCAGG + Intergenic
1151890497 17:76948317-76948339 CTGAGTGGGTGGAAGAGAGCAGG - Intronic
1152141486 17:78539555-78539577 CTGAGGGGATTCTGGAATGCAGG + Intronic
1152204546 17:78967556-78967578 CCGTGTGGATGGAGGGAAGCCGG + Intergenic
1152237762 17:79147434-79147456 CGGAGGGGTTGGGGGAAGGCTGG - Intronic
1152290785 17:79438814-79438836 CTGAGGGGAGGGATGAAATCTGG + Intronic
1152337187 17:79705646-79705668 CTGAGTGTAAGGAGGAAATCAGG + Intergenic
1153437297 18:5081219-5081241 ATCAGAGGCTGGAGGAAAGCAGG + Intergenic
1153997394 18:10454412-10454434 GAGAGGGGAAGGAGGGAAGCGGG + Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1154982014 18:21510357-21510379 CTGAGGGGAGGGAGGGAATGGGG - Intronic
1155191325 18:23433487-23433509 ATGAGGGGAAGAAGGACAGCTGG + Intronic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155875220 18:31078074-31078096 CTGCGGAGATGTAGGAAGGCAGG + Intronic
1155985615 18:32227725-32227747 ATGAGGGGATGATAGAAAGCAGG + Intronic
1156189517 18:34702124-34702146 CTGGTGTGATGGAGGAATGCAGG - Intronic
1157304659 18:46508168-46508190 CTGAGGCGATGCAGGACAGCTGG + Intronic
1157445419 18:47742975-47742997 GGGAGGAGATGGAGGAAGGCAGG + Intergenic
1158520436 18:58168223-58168245 TTCAGAGGAGGGAGGAAAGCAGG - Intronic
1160046579 18:75392212-75392234 CGGAGGGGAAGCAGGAGAGCAGG + Intergenic
1160237597 18:77098459-77098481 GTGTGGGGATGGATGAATGCAGG + Intronic
1160624313 18:80192534-80192556 CCCAGGGGATGGGGGAGAGCAGG + Intronic
1160635278 19:70840-70862 CGGAGGGGCTGGAGGGAGGCGGG - Intergenic
1160652223 19:237155-237177 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162084779 19:8241964-8241986 CTGAGGGAAGGGAGGAAATGAGG - Intronic
1162171182 19:8790248-8790270 CTGAGGGGAGGGAGGGAGGGAGG + Intergenic
1163128032 19:15254968-15254990 CTTTGGGGAAGGAGGAAAGGCGG - Intronic
1163360272 19:16841603-16841625 CTGAGAGCCTGGAGGCAAGCAGG - Intronic
1163383748 19:16986249-16986271 CTCAGGGCATGGAGGGAAGATGG - Intronic
1164250140 19:23468755-23468777 AGGAGGGGAAGGAGGAAAGGAGG - Intergenic
1164250157 19:23468828-23468850 TTGAGGAGAAGGAGGAAAGTAGG - Intergenic
1165013848 19:32866797-32866819 CAGAGGGGATGGAGGAGGGACGG - Intronic
1165424856 19:35740095-35740117 ATAAGGGGTTGGAGTAAAGCTGG + Intronic
1165741189 19:38206257-38206279 CTGAGGGGAAGGAGCGAAGGCGG - Exonic
1165773584 19:38391923-38391945 CTGAGGGGCAGAAGGAAAGCAGG - Intronic
1166320769 19:42017604-42017626 CAGAGAGGTTGGAGGAAACCAGG + Intronic
1166360721 19:42251929-42251951 CTGAGGGGCTGGTGGAAGGCTGG - Intronic
1166763944 19:45241515-45241537 CTTAGGAGATGGAGAAGAGCAGG - Intronic
1167510985 19:49895263-49895285 CTGTGGGGATGGAAGAAGGCAGG - Intronic
1167737017 19:51300919-51300941 CAGAGGGGATGGAGGAGGGATGG + Intergenic
1168072079 19:53958984-53959006 CTGAGAGGATGGGGGAGAGAGGG - Intergenic
1168156239 19:54474269-54474291 CGCAGGGGATGGAGTGAAGCAGG + Intergenic
1168162694 19:54522167-54522189 AGGAGGGGATGAAGGAAAGGGGG + Intergenic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
1168481023 19:56719693-56719715 CTGCTGGGATGGAGGAAAGATGG + Intergenic
926104377 2:10141313-10141335 GGGAGGGGATGGAGGGAAGATGG - Intergenic
926141304 2:10370160-10370182 CTGAAGGGAAGGAGAAATGCAGG - Intronic
926587149 2:14699366-14699388 CTGAGTGCATGGAGGAAGGAGGG - Intergenic
926597316 2:14805362-14805384 ATGAGGGTAAGGAGGAAAACCGG + Intergenic
926709817 2:15869953-15869975 CCGAGGAGATGCAGGTAAGCCGG - Intergenic
926809590 2:16744690-16744712 CTGAAGGGATCCTGGAAAGCTGG - Intergenic
926884185 2:17582225-17582247 GTGAGGGGAAGGAGGAAGGTGGG + Intronic
927148647 2:20183233-20183255 ATGAGGGGAGGGAGGAGAGCAGG + Intergenic
927281825 2:21315436-21315458 GTGGGGGGATGGAGGAACACAGG + Intergenic
927315369 2:21675295-21675317 AGGAGGGGATGGTTGAAAGCTGG + Intergenic
927512105 2:23650195-23650217 CTCAGGGGCTGGAGAAAAGAGGG + Intronic
928339338 2:30428002-30428024 CTGAGCGGCAGGAGGAAAACTGG - Intergenic
928785875 2:34885487-34885509 TAGAGGGAATGGAGGAAAGTGGG - Intergenic
929057912 2:37894454-37894476 CTGTCTTGATGGAGGAAAGCTGG - Intergenic
929759944 2:44798463-44798485 ATGCGGGGCTGGAGGAAAGCAGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
931628963 2:64282612-64282634 ATGTGGGGATTGAGGAGAGCAGG + Intergenic
933319353 2:80754019-80754041 GTGAGGGGAAGGAGGAAATGGGG - Intergenic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933362264 2:81303160-81303182 CAGTGGGCCTGGAGGAAAGCAGG - Intergenic
934607742 2:95710286-95710308 CTGAGGGGATGGGGGAAATCAGG + Intergenic
934647549 2:96067983-96068005 CAGAGGGGATGGGGGAATGGGGG + Intergenic
934840923 2:97623803-97623825 CAGAGGGGATGGGGGAATGGGGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
935356880 2:102209594-102209616 CTGAGGTCATGGAGTTAAGCAGG + Intronic
935405470 2:102704787-102704809 CTGAGGAGCTGCAGGAAGGCTGG + Intronic
935503234 2:103868065-103868087 CTTAGAGGAAGGAGGAAAGAGGG + Intergenic
935848486 2:107193016-107193038 CTGAGGGAAAGGAGGAAACAAGG + Intergenic
936248132 2:110846258-110846280 AAGAGGGGATGAAGGAAAGGGGG + Intronic
936541083 2:113352166-113352188 CTGAGGGGACGGGGGAAATCAGG + Intergenic
936566202 2:113584203-113584225 CGGAGGGGCTGGAGGGAGGCGGG + Intergenic
937130569 2:119509219-119509241 CCCAGGGGATGGAGCCAAGCCGG + Intronic
937479201 2:122241544-122241566 ATGGGGGGAGGGAGGAAAGGAGG + Intergenic
937564143 2:123263005-123263027 CTGTGGGGATTGAAGAAAGTAGG + Intergenic
937992536 2:127672612-127672634 CTGAGCGGGTGGAGGAGAGGAGG - Intronic
938792974 2:134692951-134692973 CTGAGGTGCTGGAAGAAAGATGG - Intronic
941622088 2:167789770-167789792 CTGTGGGGGAGGAGGAAAGGTGG - Intergenic
941899974 2:170668925-170668947 CTGCAGGGATAAAGGAAAGCAGG + Intergenic
942409758 2:175696488-175696510 CTAAGAGAATGGAGGAAAGAAGG + Intergenic
943499199 2:188666032-188666054 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
943499228 2:188666112-188666134 ATGAGGGAAGGGAGGAAAGAAGG - Intergenic
944454896 2:199883276-199883298 CAGAGGATATGTAGGAAAGCTGG + Intergenic
944822444 2:203444080-203444102 GTGAGGGGAGGGAGGAAAGGAGG + Exonic
945024638 2:205608212-205608234 CTAAGGGGCAGGAGGAAATCAGG + Intronic
945333929 2:208569750-208569772 CTGAGGTGTGAGAGGAAAGCAGG + Intronic
946184787 2:217974378-217974400 CTGAGGGGATGGAGGAAAGCAGG - Intronic
946327144 2:218990604-218990626 ATGAGGGGGTGGAGGAAATAAGG - Intronic
946386766 2:219388245-219388267 CGGAGCGGATGGGGGAAACCTGG - Intronic
946427875 2:219609009-219609031 CTGAGAGCATGGAGGATGGCAGG - Intronic
947332417 2:229044221-229044243 GTCAGGTGATGGGGGAAAGCAGG - Intronic
947742400 2:232490679-232490701 GGGAGGGGGTGGAGGAAGGCCGG + Intergenic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948636059 2:239338354-239338376 CTGATGGAATGAAGGGAAGCGGG - Intronic
1169228447 20:3870854-3870876 ATGAGGGGAAGCAGGGAAGCAGG - Exonic
1169880071 20:10337496-10337518 CTGAGAGGAAGGTGGAAAGGAGG - Intergenic
1170020673 20:11833889-11833911 GGGAGGGGAGGGAGGAAAGTAGG + Intergenic
1170531270 20:17294833-17294855 CAGAGGAGATGGAGGAAAACAGG - Intronic
1170748687 20:19124460-19124482 CTGAGAGTATTGAGGAATGCGGG + Intergenic
1171459744 20:25291820-25291842 CTGAGGTGAGGGTGGAGAGCAGG + Intronic
1171967588 20:31542191-31542213 CTGGGGGATTGGAGGAAGGCAGG + Intronic
1172180572 20:33001025-33001047 CTGAGGGGCTGGAGCAATGGGGG + Intronic
1172590290 20:36112934-36112956 ATCAGGGGATGGGGGAAAGTAGG + Intronic
1173284732 20:41659934-41659956 CAGAGGGGAAGGATGAAAGGAGG - Intergenic
1173759136 20:45544622-45544644 CTGAGGGGATGAAGAAGAGTAGG - Intronic
1173854019 20:46238146-46238168 CTGAAGGACTAGAGGAAAGCAGG - Intronic
1173918245 20:46725556-46725578 CTGAGGGATTGCAGGACAGCAGG - Exonic
1174568979 20:51487658-51487680 CTGAGGAAATGCAGGACAGCCGG + Intronic
1175216891 20:57395902-57395924 CTGAGGGCATGGAGGGAGGTGGG + Intronic
1175306001 20:57975905-57975927 CTGAGGCCATGAAGGAAAGGAGG + Intergenic
1175798664 20:61788328-61788350 CTGAGGGGCTGGGGGAGGGCTGG + Intronic
1175804494 20:61820039-61820061 CTGAGGGGATGGGAGAGTGCGGG - Intronic
1175870904 20:62208963-62208985 CTCAGGGGCTGGAAGAAGGCAGG - Intergenic
1176740442 21:10596602-10596624 CTCAGGGGAGGTGGGAAAGCAGG + Intronic
1177406333 21:20673219-20673241 CTGAGGCTATGCAGGATAGCAGG - Intergenic
1179229666 21:39489997-39490019 ATGAGGGTATGGAGAAAAGAAGG + Intronic
1179478266 21:41661519-41661541 CTCGGGGGACGGAGGAAAGGGGG + Intergenic
1179966478 21:44809698-44809720 CTGAGGAGCAGGAGAAAAGCTGG + Intronic
1180007454 21:45029423-45029445 CTGGGGTGCTGGAGGCAAGCGGG + Intergenic
1180120965 21:45747819-45747841 CTCAGAGGAGGGAGGAAAGAAGG - Intronic
1180146347 21:45921855-45921877 GTGAGGAGCTGGAGAAAAGCAGG - Intronic
1180735025 22:18010028-18010050 GGGAGGGGAGGGAGGGAAGCAGG + Intronic
1181151688 22:20888458-20888480 ATGGGGGGCTGGAGGGAAGCGGG - Exonic
1181958393 22:26604966-26604988 CAGAGGGAGTGGAGGAAAGAGGG - Intronic
1182098924 22:27644603-27644625 CTGAGTGGATGGACGGAAGTAGG + Intergenic
1182336801 22:29589002-29589024 CTGAGGGAATGGATGATGGCAGG - Intergenic
1182748939 22:32626539-32626561 CAGAGGGGAGGAAGGAAGGCGGG + Intronic
1183165974 22:36147705-36147727 CTGAAAGGATGAAGGAAACCAGG + Intronic
1183359582 22:37376527-37376549 CTTTGGGCATGGAGGAAAGGAGG - Intronic
1183399348 22:37592871-37592893 CTGTGGGGATTGAGAAAAGAGGG - Intergenic
1183509570 22:38227011-38227033 CGGAGGGGATGGAGGGACGAAGG + Intronic
1183862479 22:40679863-40679885 CTGAGGGGCAGGAGAAAAGGGGG + Intronic
1184492940 22:44820615-44820637 ACAAGGGGAGGGAGGAAAGCGGG - Intronic
1184612349 22:45612862-45612884 CTCTGGGGAAGGAGGAAAACAGG + Intergenic
1184717602 22:46290790-46290812 CTAAGTGGAGGGAGGCAAGCTGG - Intronic
1184730377 22:46368312-46368334 CAGAGGGGATGGAGTGAATCCGG + Intronic
1184938372 22:47741426-47741448 CTGGGCAGAAGGAGGAAAGCAGG - Intergenic
1185036941 22:48484454-48484476 GGGAGGGGAGGGAGGAAGGCAGG - Intergenic
1185114787 22:48926581-48926603 GGGAGGGGAGGGAGGAAGGCAGG - Intergenic
951279685 3:20732408-20732430 CTGGGGGGATGGAGGAGGGATGG + Intergenic
952102668 3:30032950-30032972 CTGAGGGGATGGAGGTAAGAGGG + Intergenic
952106754 3:30079000-30079022 CACAGCAGATGGAGGAAAGCAGG - Intergenic
952307268 3:32157335-32157357 CAGAGGGGATGGAGTGAACCTGG - Intronic
952383033 3:32818866-32818888 CTGAGAGGATGGAGAAGGGCGGG - Exonic
952408580 3:33026749-33026771 CTGAGAGGATGGAGGGAGGATGG + Intronic
952740742 3:36731798-36731820 GTGAGGGGAGGGAGAAAAGAAGG - Intronic
953127038 3:40101185-40101207 CTGGGAGAATGGAGGAAAGGGGG - Intronic
953532676 3:43752552-43752574 CTCAGAGGATGGGGGAAAGCAGG + Intergenic
954410064 3:50366661-50366683 GTGATGGGAGGGAGGAAAACTGG - Intronic
954420945 3:50418752-50418774 GTGGAGGGATGGAGGAATGCAGG + Intronic
955018147 3:55091540-55091562 CGGAGGGGATGCACGAGAGCTGG - Intergenic
956067135 3:65408790-65408812 CTGAGGGTAGGAAGGAAAACAGG + Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956486883 3:69732209-69732231 CTGAGAGGATGAAGGAAGGGTGG + Intergenic
956761596 3:72448617-72448639 CTTAGGGGAGGGATGAAAGAAGG + Intergenic
956766929 3:72491959-72491981 CTGGGAGGATGGTGGAAAGAAGG + Intergenic
957587045 3:82146122-82146144 CTGAGGGGCTGGGGTACAGCTGG - Intergenic
958707462 3:97673751-97673773 CTGAGGGCATTGAGGAATGGAGG + Intronic
959941156 3:112082997-112083019 GTTAGGGGATGGAGGAGGGCTGG + Intergenic
961010127 3:123430032-123430054 CTGAGGGCATGGGGGAATGGAGG - Intronic
961175893 3:124834663-124834685 GGGAGGGGAGGGAGGAAAGAAGG + Intronic
961816206 3:129551753-129551775 CTGAGGGGTGGGATGAAAGGAGG + Intergenic
961921469 3:130430732-130430754 CTCAGGGGCTTCAGGAAAGCTGG - Intronic
962366942 3:134793174-134793196 TTAAGGGGAGGGAGGGAAGCTGG + Intronic
962850035 3:139301511-139301533 CAGAGGGAATGAAGGGAAGCTGG - Intronic
963043181 3:141083877-141083899 CAGAGGGGAGGGAGGTAAGCAGG - Intronic
964769840 3:160212621-160212643 CTGAGGGCAAGGAGCAGAGCAGG - Intergenic
966769623 3:183492229-183492251 CTGAGGAGAGGGAGGAAACACGG + Intronic
966811986 3:183855135-183855157 CTGAGGGGAAGGAGGGAAGGAGG + Intronic
967258153 3:187614145-187614167 AAGAGAGGATGGAGGAAAGTGGG - Intergenic
967350763 3:188511300-188511322 GAGAGGGGAGGGAGGAAGGCAGG - Intronic
967684235 3:192400741-192400763 TTGTGGAGATGGAGGAATGCTGG - Intronic
967955890 3:194876918-194876940 CTTGGGGGATGCAGGGAAGCTGG + Intergenic
968365610 3:198182817-198182839 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
968953929 4:3708655-3708677 CTGAAGGGATGGAGGTCCGCAGG + Intergenic
969559092 4:7934607-7934629 CAGAGGAGAGAGAGGAAAGCAGG + Intronic
970268446 4:14316049-14316071 CTGAGGGGAAGGAAGACAGTAGG + Intergenic
970688647 4:18596920-18596942 AGGAGAGGATGGAGGAAAGAAGG + Intergenic
972418337 4:38864187-38864209 ATGAGGTGGTGGAGTAAAGCAGG - Intergenic
973762917 4:54136678-54136700 GTGAGGGGAATGAAGAAAGCTGG + Intronic
973913220 4:55605033-55605055 CTGTGGACATTGAGGAAAGCTGG - Intronic
974144076 4:57924250-57924272 CTGAGGGGACGAAGCACAGCAGG + Intergenic
974360532 4:60872647-60872669 GTGAGGAGAAGGAGCAAAGCAGG - Intergenic
974671766 4:65039504-65039526 CTGAGGGGTGGGAGGATGGCAGG - Intergenic
974859551 4:67502993-67503015 TTGAAGGGATGGAGGAAGGTTGG - Intronic
974960058 4:68687334-68687356 CTGGGGGCATGGGGGTAAGCAGG + Intergenic
975355202 4:73394335-73394357 GTGAGGGGAAAGAGGACAGCAGG - Intergenic
976028380 4:80720038-80720060 CAGTGAGGATGGAGGAAACCAGG + Intronic
976577985 4:86698606-86698628 CTGACAGGTAGGAGGAAAGCAGG + Intronic
976699620 4:87955665-87955687 CTGAGGGGATGCATATAAGCTGG - Intergenic
977742854 4:100507507-100507529 TTGAGTGGATGGAGGGAAGAAGG + Intronic
977785683 4:101032042-101032064 ATGAGGGAATGGGGGAAAGGTGG + Intronic
978136222 4:105263880-105263902 ATGGATGGATGGAGGAAAGCTGG + Intronic
979172915 4:117624413-117624435 CTGAAGGGATGGAGGAATCTGGG + Intergenic
979254644 4:118597984-118598006 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
979334317 4:119448047-119448069 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
980076688 4:128301544-128301566 CTGAGGGCATGGGGGACACCTGG - Intergenic
982131331 4:152231222-152231244 ATGGGGGCAAGGAGGAAAGCAGG - Intergenic
982206478 4:153000795-153000817 ATGAGGGGATGGGGGAGAGTGGG + Intergenic
983919920 4:173334214-173334236 CTGAGGGAATGGGGAAAGGCAGG + Intronic
984874733 4:184357020-184357042 CTGTGGGGATGCAGCAAAGATGG + Intergenic
985110291 4:186541062-186541084 CTGAGGGAATGGAGGCAGGGTGG - Intronic
985549510 5:525843-525865 CTGAGCGGATGGATGATAGATGG + Intergenic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985805371 5:2039143-2039165 CTGGGGGGATGGAGGGGGGCTGG + Intergenic
985861107 5:2471340-2471362 CTGGGGGGTTGGGGGAAGGCTGG + Intergenic
986207747 5:5641521-5641543 GTGAGGGTGTGTAGGAAAGCAGG + Intergenic
986287715 5:6372328-6372350 CCGAGGGGCTGGAGGAGAGGCGG - Exonic
986962051 5:13225922-13225944 GTGAGTGGCTGGAGGCAAGCAGG + Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
988034790 5:25813288-25813310 CTGTGGGGGTGGAGGAAATAGGG - Intergenic
988716107 5:33829817-33829839 CTTTGGGAATTGAGGAAAGCTGG - Intronic
988993549 5:36693417-36693439 CTGAGGGGCTCAAGGAAGGCTGG + Intergenic
989031755 5:37126563-37126585 GTGAGAGGATGGCGGAATGCAGG - Intronic
989234720 5:39133402-39133424 CGGAGGTGTTGGAGGAAAGAAGG + Intronic
989614834 5:43329227-43329249 CTGATGAGAAGGAGAAAAGCTGG + Intergenic
990561747 5:56990506-56990528 GTGAGAGGAAGGAGGAAAGAAGG - Intergenic
991359403 5:65803604-65803626 CTTAGGGGCTGGAAGAAGGCAGG - Intronic
991478530 5:67050421-67050443 CTGAGGGGCAGGAGGTGAGCAGG - Intronic
991592118 5:68264207-68264229 CAGAGGTGATGGTGAAAAGCTGG + Intronic
992531213 5:77653371-77653393 ATGAGGGGATGGTGCAAAGTGGG + Intergenic
992723418 5:79582597-79582619 TTTAAGGGATGGATGAAAGCAGG - Intergenic
993033288 5:82729029-82729051 CTCAGGGGAGGGAGAAAGGCAGG + Intergenic
993353745 5:86881113-86881135 CTTAGGGGATGGAGAAGTGCAGG + Intergenic
994673669 5:102794231-102794253 CTGAGGTGAAGGAGGGAGGCTGG + Intronic
995239140 5:109865944-109865966 ATGAGGTTTTGGAGGAAAGCTGG - Intronic
995809844 5:116093360-116093382 CTGAGGAGAGGGAGGAGAGGTGG + Intronic
997383048 5:133450998-133451020 ATGATGGGAGGGAGGAAAGAAGG + Intronic
997418848 5:133750439-133750461 GTGATGGGAGGGAGGGAAGCTGG - Intergenic
998203989 5:140146242-140146264 CGGAGGGGAGGGAGGGGAGCTGG - Intergenic
999006960 5:147992118-147992140 CTGAGGACAGGGAGGACAGCAGG + Intergenic
999438507 5:151582671-151582693 GAGAGGGGATGGAGGACATCAGG + Intergenic
999467601 5:151822420-151822442 CTGAGGGCTGGGAGGAAAGGAGG - Intergenic
999946362 5:156600305-156600327 GGGAGGGGATGGAGGAGAGAAGG - Intronic
1000903728 5:166937717-166937739 GAGAGGGGAAGGAGGAAAGAAGG + Intergenic
1001247160 5:170113368-170113390 CTTCGGGGCTGAAGGAAAGCAGG - Intergenic
1001333316 5:170777542-170777564 CTCAGGGGTTGCAGGAAGGCTGG - Intronic
1001353932 5:171002300-171002322 CTGATGAGAAGGAGGAAAACTGG + Intronic
1001640502 5:173240541-173240563 GTGAAGGGATGGAGAAAATCAGG - Intergenic
1001708978 5:173762695-173762717 CTGAGGGGATGTGGGTAACCAGG + Intergenic
1001930297 5:175668169-175668191 CTGGGGAGCTGGAGGAAGGCAGG + Intronic
1002325784 5:178404704-178404726 CTGAGGGGACGGAGGACATGAGG - Intronic
1002681738 5:180970295-180970317 GGGAAGCGATGGAGGAAAGCCGG - Intergenic
1003073173 6:2960440-2960462 AGGAGGGGATGCAGGAATGCAGG + Exonic
1003868033 6:10381360-10381382 CTTTGGGGAGGGTGGAAAGCCGG - Intergenic
1003874446 6:10423640-10423662 GAGGGGGGATGGAGGAAAGGGGG + Intergenic
1004396039 6:15247442-15247464 TTGAGGGGAGGGAGGAAAGGGGG + Intronic
1004420605 6:15466167-15466189 CAGAGGGGAGAGAGGAAGGCTGG + Intronic
1004713674 6:18195982-18196004 CTGAGGGGAGGGGGAATAGCGGG - Intronic
1004738603 6:18433553-18433575 CTGAGTGGAGGGAGAAAAGACGG + Intronic
1005269955 6:24153049-24153071 CTGAGGGGCTGGGGGAAGCCAGG + Intronic
1006406948 6:33851001-33851023 CTGAGGTGAGGGAGGAGAGCTGG + Intergenic
1006439232 6:34042888-34042910 ATGTGGGGATGGGGGATAGCTGG + Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1007368144 6:41408861-41408883 CTGAGCGGATGGAGTGAACCTGG + Intergenic
1007433826 6:41793614-41793636 CTGAGGGGCTGGATCAAAGCTGG + Exonic
1007624173 6:43233615-43233637 GTGATGGGATGGAGGAATGAGGG + Intergenic
1007834957 6:44667135-44667157 GGGAGAGGATGAAGGAAAGCAGG + Intergenic
1007958202 6:45935990-45936012 CAGGGAGGATGGAGGAAATCGGG - Intronic
1008206425 6:48664687-48664709 CTGTGGGGGTGGGGAAAAGCTGG + Intergenic
1010732163 6:79402839-79402861 CTGAGTGGAAGAAGGAAGGCTGG - Intergenic
1013111717 6:107069867-107069889 CTACGGGGACGGTGGAAAGCAGG - Exonic
1013367842 6:109448444-109448466 CTGAGGGGAGGAAGGGCAGCAGG + Intronic
1013384419 6:109610935-109610957 TGGAGGGGATGGAGAAAAGGTGG + Intronic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1017746526 6:157451895-157451917 TTGAGGGGAAGCAAGAAAGCAGG + Intronic
1018368325 6:163144955-163144977 CAGAGGGGATGGGGAAAAGAGGG - Intronic
1018677769 6:166237250-166237272 AGGAGGTGAAGGAGGAAAGCAGG + Intergenic
1019103334 6:169649748-169649770 TGGAGGGGATGGAGGAATGGAGG - Intronic
1019103488 6:169650389-169650411 ATGAGGGGATGGAGGGATGACGG - Intronic
1019324172 7:429945-429967 CGGAGGCGATGGAGGGAGGCAGG - Intergenic
1019495449 7:1337586-1337608 GGGAGGGGAGGGAGGAAAGGAGG - Intergenic
1020034050 7:4953135-4953157 CTGTAGGGATGGAGGAAACAGGG - Intronic
1020456865 7:8383870-8383892 CTGAGGGAAAGGGGGAAAGAAGG + Intergenic
1020693284 7:11385863-11385885 GTGAGGGGGTGGAGGTAAGGGGG - Intronic
1021056764 7:16058717-16058739 GTTAGGAGATGGAGGAAAGAGGG + Intergenic
1022509442 7:30925840-30925862 TGGAAGGGATGGGGGAAAGCAGG + Intergenic
1024001110 7:45189863-45189885 CTGAAGGGAAGAAGGAAAGCAGG + Intergenic
1024069737 7:45775650-45775672 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
1024984882 7:55186337-55186359 ATGAGGGGAGGGAGCAAACCTGG - Intronic
1024986653 7:55200020-55200042 CTGAGGGGATGGAGCAGTGTGGG - Intronic
1025099651 7:56124003-56124025 CTGAGGGGATGGGGCTGAGCTGG + Intergenic
1026797474 7:73375712-73375734 CTCAGGGGAGGCAGGAGAGCAGG + Intergenic
1028589527 7:92480690-92480712 CTGATGGGAAGGAGAAAAACTGG + Intergenic
1028929681 7:96398482-96398504 CTCAGGGGATGGAGGAGGGGTGG + Intergenic
1031593825 7:123625203-123625225 CTGATTGGATTTAGGAAAGCAGG - Intronic
1032047126 7:128619935-128619957 CTGAGGGGATGGGGCTGAGCTGG - Intergenic
1032331325 7:130983216-130983238 CTGAGGGGCTGAAGGGGAGCTGG + Intergenic
1033172313 7:139095026-139095048 CAGAGGGGATGAAGGAGAGAAGG - Intronic
1033422838 7:141218332-141218354 CAGTGGGGATGGAGGAAGGGAGG + Intronic
1034740391 7:153468081-153468103 TTGAGGGGATGGAGAAAAGGTGG - Intergenic
1034785158 7:153919368-153919390 CAGAGGGCCTGAAGGAAAGCTGG + Intronic
1034820202 7:154210202-154210224 CTGAGGGCCTGAAGGAGAGCAGG - Intronic
1034955983 7:155335127-155335149 CTGAGGGGAATGAGGACTGCGGG - Intergenic
1035008033 7:155684373-155684395 CTGGGTAGATGGAAGAAAGCAGG - Intronic
1035038085 7:155908372-155908394 CTGAGGGCAGGGAGGAGAGGGGG - Intergenic
1035820558 8:2587338-2587360 GGGAGGGGAGGGAGGAAAGGAGG - Intergenic
1035825641 8:2641842-2641864 CTGAGAGGATGGAGTGAAGGAGG + Intergenic
1036130647 8:6106476-6106498 ATGAGGGGATGGAAGAAAGAAGG - Intergenic
1036663699 8:10725635-10725657 CTGAGCGGTGGGAGGAAAGCTGG + Exonic
1036799240 8:11777530-11777552 CTGCAGGGAGGGAGGAAAGGGGG - Intronic
1037877311 8:22554429-22554451 CTGTGGGGAAGGAGGAAGGAAGG - Intronic
1037951314 8:23020015-23020037 CAGAGGGGAGGGAGGAAGGAAGG + Intronic
1037981585 8:23258220-23258242 CAGATGGGAGGGAAGAAAGCTGG + Intronic
1038650949 8:29402613-29402635 CTCTGGGGAGGGAGGAAAGGGGG + Intergenic
1038686080 8:29719541-29719563 GTGAAGGGAGGAAGGAAAGCTGG - Intergenic
1039437597 8:37570709-37570731 CCAAGGGGATGGTGGTAAGCAGG + Intergenic
1039971535 8:42325039-42325061 GTGAGGGGATGAAGGACTGCAGG + Intronic
1040010883 8:42660084-42660106 CAGAGGGGAGTGAGGCAAGCTGG + Intergenic
1040445972 8:47494003-47494025 GTGAGGGGAAGGAGAAAAGAAGG - Intronic
1040464282 8:47679577-47679599 TGGAGGGGATGGAGGCAGGCGGG - Intronic
1040464294 8:47679620-47679642 TGGAGGGGATGGAGGCAGGCGGG - Intronic
1041168371 8:55114696-55114718 CTGAGGGGAGGGCAGAGAGCTGG + Intronic
1042745111 8:72098787-72098809 CTGAAAGAATGGAGGGAAGCTGG - Intronic
1044297815 8:90548702-90548724 CGGAGAGGATGGAGGAGAGGTGG + Intergenic
1044313279 8:90720468-90720490 CTGAGTGGATTAAGGTAAGCTGG - Intronic
1044323510 8:90833208-90833230 GTGATGGGATGGAGGATGGCAGG - Intronic
1044613675 8:94118758-94118780 CTGAGGGGATGGAGAAAAATGGG + Intergenic
1044727665 8:95206632-95206654 CTGTTGGGAAGGAGGAAAGAGGG - Intergenic
1045414540 8:101952976-101952998 CCGTGGGGATGAAGGAAAGGAGG - Intronic
1045824977 8:106386625-106386647 CTTAGGGGTTGGAGGAGGGCAGG - Intronic
1046816954 8:118595792-118595814 CTGTGGGGAAGGAGGAAAAGAGG - Intronic
1048599607 8:135905966-135905988 TTCAGGGGATGGAGATAAGCGGG - Intergenic
1049178323 8:141207235-141207257 CTGTGTGCATGGAGGAAATCAGG + Intronic
1049272397 8:141702883-141702905 GAGAGGGGAAGGAGGAAAGAAGG - Intergenic
1049316149 8:141969421-141969443 CTTGGGGGATGGAGGAGAACCGG - Intergenic
1050412629 9:5382571-5382593 CTGAGGTAATGGAGGAAGGAGGG + Intronic
1050504175 9:6330013-6330035 CTGAGGGGCTGGAGGAAAACAGG + Exonic
1050544919 9:6701593-6701615 CTGGAGGAATGGAAGAAAGCAGG + Intergenic
1052274388 9:26661068-26661090 ATGAAGGGATGGAGGAAAGGAGG + Intergenic
1052277330 9:26692026-26692048 ATGAGGGGTAGGAGGAGAGCAGG + Intergenic
1052349553 9:27444357-27444379 CTGAAGAGGTGGAAGAAAGCAGG - Intronic
1053307658 9:36995548-36995570 CTGTGAGAATGGAGGAAAGGAGG + Intronic
1054818737 9:69500437-69500459 CTGAAGGCTGGGAGGAAAGCAGG + Intronic
1056441368 9:86624990-86625012 TTGAGGGAACGGAGGAAAACCGG - Intergenic
1056902120 9:90609499-90609521 CTGGGGTTGTGGAGGAAAGCAGG + Intergenic
1057054102 9:91948838-91948860 CTGCGGGGGTGGAGGAGGGCGGG - Intronic
1057211903 9:93205099-93205121 CAGAATGGATGGAGGAAAGCAGG - Intronic
1057303726 9:93900809-93900831 CTGAGGGCAAGGAGGAAATGAGG - Intergenic
1057752691 9:97804835-97804857 AAAAGGGGAAGGAGGAAAGCAGG - Intergenic
1058455097 9:105131370-105131392 GTGAGGGAAGGTAGGAAAGCAGG + Intergenic
1058528759 9:105885623-105885645 GAGAGGGGAAGGAAGAAAGCAGG - Intergenic
1060260588 9:122070646-122070668 CTGAGGGGACAGAGGAATGAAGG + Intronic
1061254607 9:129447236-129447258 CTGAGGGGATGGTGAATAACTGG - Intergenic
1061526303 9:131166697-131166719 CTTAGGGGAAGAAGGAAAACTGG - Intronic
1061778596 9:132982836-132982858 CTGGGGGGAGGCAAGAAAGCGGG + Intronic
1061874970 9:133539114-133539136 GTGAGGGGCTGGAGGGAGGCAGG + Intronic
1061940519 9:133881389-133881411 CTGATGGGATGCAGGAGAGCTGG - Intronic
1062184913 9:135213050-135213072 CTGGAGGGAGGGAGGACAGCAGG + Intergenic
1062384228 9:136302746-136302768 CTGTCGGGAGGGTGGAAAGCGGG - Intronic
1185894374 X:3844375-3844397 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185899492 X:3882799-3882821 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1185904608 X:3921228-3921250 GCGAGGGGGTGGAGGAAAGGGGG - Intergenic
1186371959 X:8955877-8955899 CTCATGAGATGGAGGAAAGAGGG - Intergenic
1186559482 X:10595658-10595680 CTGAGGGTATGGGGGAAGGGAGG + Intronic
1186564138 X:10644364-10644386 CTGAGAGGAAGGAGGAATGAAGG - Intronic
1187039669 X:15580299-15580321 CAGAGGGGAATGAGGGAAGCAGG - Intronic
1187485653 X:19700734-19700756 CTCAGAGGATGTGGGAAAGCTGG + Intronic
1187546223 X:20255317-20255339 CTGGGGGAATGGAGGAAATGGGG + Intronic
1187715888 X:22102201-22102223 CAGAGGGGAAGGAGGGAAGGAGG - Intronic
1188520178 X:31030076-31030098 AGAAGGGGAAGGAGGAAAGCAGG + Intergenic
1188820158 X:34765369-34765391 CTGAGAGGATGGGAGAAAGAGGG - Intergenic
1188867251 X:35328299-35328321 CTGAGGGGGTTGAGAAATGCTGG - Intergenic
1189271881 X:39757826-39757848 GTGTGGGGATGGTGGAAAGTAGG - Intergenic
1189637402 X:43025796-43025818 CTGAATAGATAGAGGAAAGCTGG + Intergenic
1189913466 X:45834785-45834807 GTGGGGGGTTGGAGGAAAGTGGG + Intergenic
1190546113 X:51529304-51529326 CTGAGGGAAGGGAGAAATGCAGG + Intergenic
1191073016 X:56421765-56421787 CTGGGGGGATGGAGCCAAGATGG - Intergenic
1191688953 X:63920512-63920534 CTTAGGGGATGGGGGGAGGCTGG + Intergenic
1192299182 X:69882214-69882236 CTGAGCAGATTGAGGCAAGCAGG + Intronic
1192545091 X:72006512-72006534 CTGAGGGGTTGGGGAAATGCAGG - Intergenic
1193746643 X:85289912-85289934 ATAAAGGGAGGGAGGAAAGCAGG + Intronic
1195243909 X:102979274-102979296 GTGAGGGGCTTGAGTAAAGCTGG - Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1195872698 X:109502486-109502508 CTGAGGGCTTTGTGGAAAGCAGG - Intergenic
1196079181 X:111612803-111612825 CTGAGGGGTTGCACTAAAGCTGG + Intergenic
1196765285 X:119236784-119236806 CTGAGTGGAGGGAGGAATGGCGG + Intronic
1197634553 X:128900477-128900499 CTGAGGGCAATGAGAAAAGCTGG - Intergenic
1197816852 X:130506586-130506608 TTGAAGGGAGGGAGGAAAGAAGG - Intergenic
1198129363 X:133678421-133678443 TTGAAGGGGTGGAGGAGAGCTGG - Intronic
1199721908 X:150548166-150548188 CTAAGGGCAGGGAGGACAGCAGG - Intergenic
1199766385 X:150944584-150944606 CCAAGGGGAAGGAGGACAGCAGG + Intergenic
1199850110 X:151720168-151720190 AGGAGGGGAGGGAGGAAAACAGG - Intronic
1200105372 X:153709127-153709149 CTGAGGGGTTTGGGGTAAGCTGG + Intronic
1200258948 X:154601414-154601436 CTCAGGGGAGTGAGAAAAGCCGG + Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1201438409 Y:13984885-13984907 CTGTGGGGAGGGAGGAAGGGGGG - Intergenic
1201438446 Y:13985005-13985027 CTGTGGGGAGGGAGGAAGGGTGG - Intergenic
1201446127 Y:14057703-14057725 CTGTGGGGAGGGAGGAAGGGTGG + Intergenic
1201446164 Y:14057823-14057845 CTGTGGGGAGGGAGGAAGGGGGG + Intergenic
1202598721 Y:26570482-26570504 CTCAGGGGAGGCGGGAAAGCAGG + Intergenic