ID: 946185245

View in Genome Browser
Species Human (GRCh38)
Location 2:217977225-217977247
Sequence CTGGATAAACAGAACAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 329}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185245 Original CRISPR CTGGATAAACAGAACAAGGA GGG Intronic
901226946 1:7618883-7618905 CTGGATTAAAAAAAAAAGGATGG - Intronic
901400240 1:9010751-9010773 ATGAATGACCAGAACAAGGAAGG - Intronic
902683557 1:18060675-18060697 CTGCATAAATAGAACCGGGAAGG - Intergenic
903423390 1:23234951-23234973 CTGGATAAAGAAAACATGGCGGG - Intergenic
904494387 1:30878462-30878484 CTGGATCCCCAGAACAAGAAGGG - Intronic
905208333 1:36355881-36355903 CTGGATACACAGAACCTGTATGG - Intronic
906631910 1:47377787-47377809 CTGAATAAAAATAGCAAGGAAGG - Exonic
906826635 1:48988430-48988452 CTGGATAAACAGTATAGGGAAGG + Intronic
906858551 1:49333795-49333817 ATGGCCAAACTGAACAAGGAGGG - Intronic
906949131 1:50320004-50320026 CAAGATAAACTGGACAAGGAGGG - Intergenic
907887622 1:58607679-58607701 TTGGATAATCAGGACAAGAACGG - Intergenic
908127369 1:61044366-61044388 CTGAGTAAACAAATCAAGGATGG + Intronic
908478512 1:64512970-64512992 ATGGAAAAACAGAACAAGGATGG - Intronic
909754241 1:79203536-79203558 CAGGATTAACAAAATAAGGAGGG + Intergenic
912531526 1:110327345-110327367 CTTTAAAAACAAAACAAGGAAGG + Intergenic
913096280 1:115519143-115519165 CTGGATAAAAAGAACAAAACCGG - Intergenic
913366291 1:118042884-118042906 ATGCATAAACAAAGCAAGGAAGG - Intronic
914082975 1:144426538-144426560 CTGTTTAAAAAGAAAAAGGACGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
917498117 1:175561039-175561061 CTGAATTAGAAGAACAAGGAAGG - Intronic
918670450 1:187208281-187208303 ATGAATGAACAGAAAAAGGATGG + Intergenic
919145185 1:193625278-193625300 CTGGACAAACTGAAAAACGAGGG + Intergenic
919244204 1:194956879-194956901 CTGAATAAAAAGAACAACGCTGG - Intergenic
921739460 1:218667305-218667327 CTGTTTTAAAAGAACAAGGAAGG + Intergenic
922504539 1:226118901-226118923 TTGGAGAGCCAGAACAAGGATGG + Intergenic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923351788 1:233114614-233114636 CTGGATAAACAGAAAACTGATGG + Intronic
924930587 1:248728767-248728789 ATGCATAAACAAAGCAAGGAAGG + Intronic
1063075381 10:2711340-2711362 CTGGATAAGTAGGTCAAGGAGGG - Intergenic
1064223738 10:13463869-13463891 GTGGAAAAACAGGAAAAGGATGG + Intronic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1064944264 10:20770680-20770702 ATGAAGAAACAGAACAAGGAAGG - Intergenic
1064947478 10:20806972-20806994 CTGCATCTACAGAACCAGGAAGG + Intronic
1066803636 10:39219083-39219105 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1067059378 10:43070204-43070226 CTGGACAGACAGAGCAAGCAGGG + Intergenic
1067166399 10:43869370-43869392 CTCGATGAACAGAACAGGGAGGG - Intergenic
1069070648 10:63987772-63987794 CAGGATTAAGGGAACAAGGAGGG + Intergenic
1069961249 10:72080695-72080717 CTGGATAAACAGAAGGAGACAGG + Intronic
1070456910 10:76626466-76626488 CTGAATAAACATTACAATGATGG - Intergenic
1073017521 10:100413434-100413456 CTGCATAAACTGAATAACGAAGG - Intergenic
1074416017 10:113267364-113267386 CTGAATAAACTGAAACAGGAAGG - Intergenic
1075049676 10:119173736-119173758 CTGGATAAATACACCAAGAAAGG - Exonic
1075900870 10:126041936-126041958 CTGCAGAAACAGTGCAAGGAAGG - Intronic
1075961998 10:126575630-126575652 CTGGTCAAAAAGAACAAGGCTGG + Intronic
1076662356 10:132064299-132064321 CTGGGGAAACAACACAAGGATGG - Intergenic
1077640388 11:3876291-3876313 ATGGATAAACAGACCTAGGTAGG + Intronic
1078028527 11:7723691-7723713 CTGGGGAAACAAAAGAAGGAAGG - Intergenic
1078363360 11:10687345-10687367 CTAGAGAAACAGAAGAGGGAGGG - Intronic
1078555284 11:12320470-12320492 GTGGATAAAGAAAACAATGATGG - Intronic
1079736700 11:24006329-24006351 CAGGAAAGAGAGAACAAGGAAGG + Intergenic
1081576554 11:44322159-44322181 TTGGATTTACAGAACAAGGTTGG - Intergenic
1082295281 11:50434086-50434108 CAGGATAAAAAGTAGAAGGAAGG + Intergenic
1082304272 11:50551883-50551905 CTGGATAAAAACTAGAAGGAAGG - Intergenic
1082826060 11:57579802-57579824 CTCAAAAAACAGAACAAGGCTGG + Intergenic
1086771373 11:90771647-90771669 CTGGACAAAAAGAACAAAGCTGG + Intergenic
1086781784 11:90916035-90916057 CTGCATAAACAGAAGGTGGAAGG - Intergenic
1088145397 11:106670745-106670767 CTGGCTAAGCAGGACAAGGTTGG - Intergenic
1090246615 11:125220685-125220707 ATGGAGAAATAGAACAAGGCCGG - Intronic
1092398643 12:8151991-8152013 CTGGATAAACAACAAAATGAAGG - Intronic
1092745642 12:11669711-11669733 CTGTATGAACAGAACATGAATGG - Intronic
1094863129 12:34493860-34493882 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1096920429 12:55079569-55079591 CTGAATAAAAAGAACAAAGCTGG + Intergenic
1098132836 12:67368360-67368382 CTGGAAACACAGAGAAAGGATGG + Intergenic
1098158584 12:67625216-67625238 CTGAATCAACAGACCAAGAAGGG + Intergenic
1099998191 12:89802692-89802714 CTGGATAACCAGGAGAGGGATGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100889168 12:99104783-99104805 AGTGATAAACAGAACTAGGAAGG - Intronic
1101071220 12:101077885-101077907 CCGGATAAGCAAAAGAAGGAGGG - Intronic
1103428580 12:120861349-120861371 CTAGAAAAACAGAAAAAGGAAGG + Intronic
1104136328 12:125942840-125942862 AGGGATAAACAGAACATGAAGGG - Intergenic
1106625844 13:31420319-31420341 CTGGATACACACAGGAAGGAAGG + Intergenic
1106721937 13:32443856-32443878 CTGGATATAAAGAAAAAAGATGG - Exonic
1107232153 13:38123003-38123025 CTGGAGAAAGAGAGCATGGAGGG + Intergenic
1107369061 13:39722370-39722392 GTGAATAATCAGAACAAGTATGG - Intronic
1107951620 13:45466982-45467004 ATGGAAAAAAAGAACAAAGAAGG + Intronic
1108701075 13:52944643-52944665 CTGGGTAAGGAGAGCAAGGAGGG + Intergenic
1108819737 13:54334153-54334175 CTGGCTAAACAGATTATGGAGGG + Intergenic
1108840665 13:54610560-54610582 GTGGATAAAAAGAACAATTAAGG + Intergenic
1110679367 13:78290325-78290347 CTGGGCAAAAAGAACAAAGACGG - Intergenic
1111243969 13:85510231-85510253 CTGGATAAACTGAAAATCGATGG - Intergenic
1111668486 13:91299687-91299709 ATGGATACATAAAACAAGGAAGG - Intergenic
1112687574 13:101849040-101849062 CTGGAAGAACTGAGCAAGGAAGG - Intronic
1112752869 13:102599456-102599478 ATGGATAGAAAGAAAAAGGAAGG + Intronic
1113217204 13:108055929-108055951 CTGGAAAAACAGAAATACGAAGG + Intergenic
1115543123 14:34441485-34441507 ATGCATAAACAAAGCAAGGAAGG - Intronic
1115972183 14:38957904-38957926 CATGACAAACAGAACAAAGATGG + Intergenic
1116905341 14:50397783-50397805 CTGGAAACCCAGTACAAGGATGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117637512 14:57760470-57760492 CTGGATAGCCAGAACAAAGCTGG - Intronic
1118049881 14:62015034-62015056 CTGGAGAAAGAAGACAAGGAAGG - Intronic
1118496297 14:66311119-66311141 CTTGAGAAAAAGAACCAGGAAGG + Intergenic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1119535761 14:75401359-75401381 CGAGATAAAAAGAACAAGGAAGG - Intergenic
1120641519 14:87019167-87019189 CAGGATATACAGAGCAAAGAGGG + Intergenic
1123669516 15:22641040-22641062 CTGGAAAACCAAAACACGGAGGG + Intergenic
1123726915 15:23112347-23112369 CTGGAGCAACACAACAAGCAGGG + Intergenic
1124525491 15:30447480-30447502 CTGGAAAACCAAAACACGGAGGG + Intergenic
1124773163 15:32560204-32560226 CTGGAAAACCAAAACACGGAGGG - Intergenic
1125360764 15:38862399-38862421 CTAGTTAATCAGAAAAAGGAAGG - Intergenic
1126430629 15:48580112-48580134 TTGGAAAAACTGGACAAGGAAGG - Intronic
1126431314 15:48588004-48588026 CTGGAGAAGCAGCAGAAGGAAGG + Intronic
1128963726 15:72036585-72036607 CTGAAGAATCAGAACAGGGATGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1130358660 15:83159611-83159633 ATAGATATACAGATCAAGGAAGG + Intronic
1134029055 16:10977382-10977404 CTGGAGAACCAGGACAAGGTGGG + Exonic
1134795117 16:17028042-17028064 CTGGATAAACAGAATAACTATGG - Intergenic
1136677880 16:31930061-31930083 CTAGAGAAACAGAACAAGACAGG + Intergenic
1137459221 16:48643897-48643919 CTGAACAAAAAGAACAAGGCTGG - Intergenic
1138154065 16:54686171-54686193 CTCAATAAAAAGAAAAAGGAAGG - Intergenic
1140964110 16:79947565-79947587 ATAGATAAATAGAAAAAGGAAGG + Intergenic
1141270337 16:82534035-82534057 CTGGGTAATCAGAATGAGGAAGG - Intergenic
1146613529 17:34331920-34331942 CTGGATAAACTGCTGAAGGATGG - Intergenic
1146947954 17:36886528-36886550 CTGGGGGAAGAGAACAAGGAAGG + Intergenic
1147011534 17:37452971-37452993 CTGGATAATCTGAAGAAGGGAGG - Intronic
1147541262 17:41361949-41361971 CGGGATAAATTGAACAAGGGCGG + Intergenic
1149143833 17:53466034-53466056 ATGCATAAACAGAGGAAGGAAGG + Intergenic
1150934618 17:69622217-69622239 CTGCATAAAAAGAACAAAGCTGG - Intergenic
1153905670 18:9659345-9659367 CTTGATGTACAGATCAAGGAAGG + Intergenic
1157051627 18:44172763-44172785 CTGGGGAAATGGAACAAGGAAGG + Intergenic
1157603278 18:48908737-48908759 CTGAATAATCAAAACAAGCAGGG + Intergenic
1158678666 18:59546884-59546906 CTAGAAAAACAGAAAAAGAATGG - Intronic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159846225 18:73464018-73464040 CTTGATCAACAGAACACTGAGGG + Intergenic
1161906637 19:7161742-7161764 AGGGATGAAGAGAACAAGGAAGG + Intronic
1165265488 19:34659838-34659860 CTAAATAAAAAGAACAAAGATGG + Intronic
1165560319 19:36673717-36673739 CTAGAGAAACAGAACAAACAGGG - Intergenic
1167565092 19:50251011-50251033 CTGGATACACAGATCAAACATGG + Intronic
1167768111 19:51497551-51497573 CCGGACAGAAAGAACAAGGACGG + Intronic
925470461 2:4155760-4155782 ATGGATAAACAGATGATGGATGG - Intergenic
927011113 2:18905383-18905405 CTTGAGAAACAGAACAAAGCAGG - Intergenic
927409929 2:22813630-22813652 CCAGAGAAACAGAACAATGAGGG + Intergenic
927436857 2:23073955-23073977 CAGGTTGAACAGAGCAAGGATGG - Intergenic
928063194 2:28135883-28135905 ATGGATAAACTGAAATAGGAAGG - Intronic
928222493 2:29416143-29416165 CCAGAGAAACAGAACCAGGAGGG - Intronic
928254152 2:29707430-29707452 CAGGGAAAACAGAACAAGGGAGG + Intronic
928455893 2:31421319-31421341 CTGGTTGAAAAGAAAAAGGACGG - Intergenic
929189889 2:39130101-39130123 CTGGGTCAACAGACCAAGAAGGG + Intergenic
930003176 2:46874958-46874980 CTGGATAAACTGAGGCAGGAAGG + Intergenic
930025581 2:47027285-47027307 CTGGACCCACAGCACAAGGAGGG + Intronic
930623631 2:53670691-53670713 CTGGAGAAACAAAAAAAGCAAGG + Intronic
931024290 2:58091750-58091772 ATGAATAAACAGAACAGAGAAGG + Intronic
931117832 2:59183700-59183722 CTAGAAAAAAAGAAAAAGGATGG + Intergenic
931258127 2:60592483-60592505 CTGAATAAAAAGAACAAAGCTGG + Intergenic
933265234 2:80174437-80174459 TTGGAAAAACAGCCCAAGGAAGG - Intronic
935115975 2:100136597-100136619 ATGGATAAACAGATCAATGGGGG - Intronic
935273662 2:101457448-101457470 CTGGATAAATAAAAAAATGAAGG - Intronic
937018254 2:118626813-118626835 CTGCATAAACAGAACAGAAAAGG + Intergenic
937248548 2:120509636-120509658 CTGGATAAACAGCTCAGGGGAGG + Intergenic
937869114 2:126775202-126775224 ATGGATACCCAGAACAAGGCTGG - Intergenic
938203710 2:129399241-129399263 CTGCTTATACAGAACAAGTAAGG - Intergenic
938841067 2:135164467-135164489 CTGGCTAAACCCAACAAGGTTGG - Intronic
939034216 2:137111712-137111734 CTGGCTAAACAGAATAAACAAGG - Intronic
939296346 2:140269661-140269683 CTGGACAATCAGATCATGGAGGG + Intronic
939817039 2:146909098-146909120 CTAGATAAACAAAACCAAGATGG + Intergenic
939817530 2:146914549-146914571 CTAGAGAAACAGAACCAGTAGGG - Intergenic
940041511 2:149366538-149366560 CCAGAGAAAAAGAACAAGGATGG + Intronic
940488832 2:154330594-154330616 CTGGATAATCAGAAGGAGCAGGG - Intronic
940568774 2:155404225-155404247 ATGCACAAACAAAACAAGGAAGG - Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
940964949 2:159826656-159826678 CTGGACAAGAAGAACAAAGATGG + Intronic
941113161 2:161440107-161440129 CTGGATGAACTGAGCAAGAAAGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
943211933 2:184977868-184977890 CTGGTTAAACTGTACAAAGAGGG - Intergenic
943458292 2:188136265-188136287 CTGGATAAACAGAACTATATGGG + Intergenic
943771254 2:191720297-191720319 CTGGACAGACAGAACGAGGCAGG + Intergenic
944208634 2:197183756-197183778 ATGGATAAAGAACACAAGGAGGG - Intronic
945110990 2:206359481-206359503 CTGAGTAAAAAGAACAAAGATGG + Intergenic
945427398 2:209723524-209723546 CTGGATAAAGGGAACCAGAATGG - Intronic
946185245 2:217977225-217977247 CTGGATAAACAGAACAAGGAGGG + Intronic
946613782 2:221487333-221487355 CTGTAAAAACAGGACAAGGCAGG - Intronic
946881590 2:224182285-224182307 CTGGCTACACAGGACAAGAAGGG - Intergenic
948371730 2:237494021-237494043 GTGGATAGAGTGAACAAGGATGG - Intronic
1168932837 20:1637839-1637861 CTGGAGAATCAGAAAAATGAGGG + Intronic
1173256833 20:41399743-41399765 CTGGAAAAACAGGATAAGGAAGG - Intergenic
1173270689 20:41532297-41532319 CTAGATAAACAGATCAGGAATGG + Intronic
1173306509 20:41855745-41855767 TTGAATAAACAGAATAAGGGAGG + Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1175913964 20:62417104-62417126 CAGGATAAACTGAACCAGGAAGG - Intronic
1177521783 21:22236136-22236158 CTGAGTCAACAGAACATGGAGGG + Intergenic
1177841613 21:26240619-26240641 CAGGATAAACACAGCATGGAAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1182173410 22:28256623-28256645 CAGGGTAAAAAGAACAAGGCTGG + Intronic
1183794801 22:40107789-40107811 ATGGATAAACAGAGAAAGGGGGG - Intronic
1184763081 22:46556338-46556360 CAGGAAAAAAAGAAAAAGGAAGG + Intergenic
1184950463 22:47838592-47838614 ATGGGTAAATGGAACAAGGAAGG + Intergenic
1184978206 22:48078129-48078151 CTGGAAAAGCAGAAGCAGGAAGG - Intergenic
949768984 3:7557798-7557820 CTGTCTTAAGAGAACAAGGAGGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
951106148 3:18745622-18745644 CTGGCTGAACGGAAGAAGGATGG - Intergenic
952006656 3:28849082-28849104 CCGGATAAAAACATCAAGGAAGG - Intergenic
952915737 3:38239748-38239770 CTGATAAAACAGTACAAGGAAGG - Intronic
954181598 3:48885507-48885529 CAAGAAAAACAGAACAAGGCTGG + Intronic
956400147 3:68870402-68870424 CTGGACAAAAAGAACAAAGCTGG + Intronic
956457129 3:69433413-69433435 GTGTAAAAACAGGACAAGGAGGG + Intronic
957080626 3:75633119-75633141 CTGGAGAAACAGCACAGGGCAGG - Intergenic
957419191 3:79947053-79947075 CTGGAAAAAAAGAACCTGGATGG - Intergenic
957480537 3:80787792-80787814 CTGAATCAACAGAAAAAGAAGGG + Intergenic
958526846 3:95271944-95271966 ATGGATAAATAGAAAAAGAAAGG - Intergenic
958529199 3:95303801-95303823 CTAGATAAAGAGAAAAAGAATGG - Intergenic
958987840 3:100803207-100803229 CTGGATAAAAAGAATAAATAGGG + Intronic
959563404 3:107808945-107808967 CTGGAGAAACAAAATAATGATGG + Intronic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960608250 3:119530465-119530487 CTGGAAACACAGAACAAGTCTGG + Intronic
962580492 3:136793270-136793292 CTGGGCAAACAGAAAAATGATGG + Intergenic
964883705 3:161454710-161454732 CTGAGTAAACAGAACAAATAGGG + Intergenic
965495090 3:169388410-169388432 ATGCACAAACAGAACAAAGAAGG + Intronic
967535482 3:190597319-190597341 CTTGATTAACAAAAAAAGGAAGG - Intronic
968805591 4:2769850-2769872 CTAGATAGGGAGAACAAGGAGGG + Intergenic
971005579 4:22370619-22370641 CTGAGTAAACAGAACAAAGCTGG + Intronic
972686428 4:41358148-41358170 CAGGAGAAAGAGAACAAAGAGGG + Intergenic
974230965 4:59112993-59113015 CTGGGTAAACAAAAAAATGAAGG - Intergenic
975618619 4:76273206-76273228 CTGGAGGAATGGAACAAGGATGG + Intronic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977504427 4:97883912-97883934 CAGGATAAATAGGAAAAGGAAGG + Intronic
977829619 4:101575445-101575467 CTGGATAAAAAGAACAAAGCTGG - Intronic
979032045 4:115661649-115661671 CTGGATAAACAGCAGAAGGAAGG - Intergenic
980282905 4:130743292-130743314 CTAAATAAACAGAACAAAGCTGG - Intergenic
981843228 4:149136455-149136477 CTGTATAAACATAAAAAAGAAGG - Intergenic
984627918 4:182029183-182029205 CAGGATCAAGAGAACAAGCAGGG + Intergenic
985888587 5:2699078-2699100 CTGGCAACACAGAGCAAGGATGG + Intergenic
985985556 5:3513109-3513131 TTAAATAAACTGAACAAGGATGG - Intergenic
986181151 5:5393955-5393977 CTGGCTCATCACAACAAGGAAGG - Intergenic
986539946 5:8834415-8834437 CTGGAGACTCAGAACAGGGAAGG + Intergenic
986676802 5:10192993-10193015 CTGGTTCAACAGAAGAAGGGTGG - Intergenic
987706981 5:21470555-21470577 CTGGCTCATCACAACAAGGAAGG + Intergenic
987949554 5:24657943-24657965 CTGGATAAATAGCAAAATGAAGG - Intergenic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990095393 5:52105444-52105466 TTGGATAAATAGAACAAACACGG + Intergenic
992138405 5:73770933-73770955 CTGGATTAGCAGAACAAGCTTGG + Intronic
992742660 5:79789830-79789852 AAGAATAAACAGAACAAGGCTGG - Intronic
992834207 5:80624204-80624226 CTGGCCAAACAGAAGAAAGAAGG - Intergenic
993367620 5:87052484-87052506 CTGAGCAAACAGAACAAAGAAGG + Intergenic
994269091 5:97755236-97755258 CTGGAGAAACTGCACAAGTAAGG - Intergenic
994356940 5:98803332-98803354 ATGTATAAACAGAAGAAGGAAGG + Intergenic
995298126 5:110543059-110543081 ATGCACAAACAAAACAAGGAAGG - Intronic
997151870 5:131505395-131505417 CTGGATAAGCAGTACATGCATGG - Exonic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997935566 5:138107754-138107776 TTGTATAAACAGAAAGAGGAGGG + Intergenic
997974495 5:138432412-138432434 TTGCATAAAAAGAACAAAGAGGG + Intronic
998476628 5:142427678-142427700 CTGGGTAAACACAACAAACAAGG + Intergenic
998771254 5:145548645-145548667 CTGGGTAGACACCACAAGGATGG - Intronic
999410098 5:151343050-151343072 CAGGAGACACAGAACAAGGCAGG + Intronic
999516995 5:152311374-152311396 CAGCATAAGCAGATCAAGGAGGG - Intergenic
1000032426 5:157415171-157415193 CTGAATAAAAAGAACAAAGCTGG + Intronic
1000059981 5:157646038-157646060 CTGGAAAAACAAACCAATGATGG + Intronic
1001570585 5:172728044-172728066 ATGGAAAAATAAAACAAGGAGGG + Intergenic
1002812811 6:649595-649617 GGGGATAACCAGAACTAGGAGGG + Intronic
1003424731 6:5990823-5990845 CTTGATTAACAAATCAAGGATGG + Intergenic
1003819269 6:9877787-9877809 CTGGAAACAAAGAACAAGGGTGG + Intronic
1004653793 6:17638382-17638404 CTGGAGAAACAGATCACAGATGG - Intronic
1005369685 6:25119231-25119253 CTGCATTAACAGAACAAAGAAGG + Intergenic
1006040225 6:31246423-31246445 CTGAATCAACAGACAAAGGAAGG - Intergenic
1006301754 6:33197323-33197345 ATGGAGACACAGAAGAAGGAAGG + Intronic
1008037666 6:46762985-46763007 CTGGTAAAACAAAAGAAGGAAGG - Intergenic
1009021244 6:57949944-57949966 CTGGCTCATCACAACAAGGAAGG - Intergenic
1009063849 6:58432313-58432335 CAGGATAAAAAGTAGAAGGAAGG - Intergenic
1009251407 6:61305198-61305220 CTGGATAAATACTAGAAGGAAGG - Intergenic
1009259354 6:61464264-61464286 CAGGATAAACACTAGAAGGAAGG + Intergenic
1009260043 6:61474556-61474578 CAGGATAAAAAGCAGAAGGAAGG + Intergenic
1009262695 6:61514782-61514804 CAGGATAAAAAGTACAAGGAAGG + Intergenic
1010878787 6:81142203-81142225 CTTGAGAACCAGAACAAGGCAGG + Intergenic
1011701582 6:89960156-89960178 CTGGAAGAACAGAAAAGGGAAGG - Intronic
1011896420 6:92232285-92232307 CTGGATTCACTGCACAAGGAGGG + Intergenic
1012667414 6:101991085-101991107 CTGGACAAAAATAACAAGTATGG + Intronic
1013066008 6:106685043-106685065 CTGTACAAACAAATCAAGGATGG + Intergenic
1015033125 6:128620351-128620373 ATGGAAAAACAGAACAATGTAGG + Intergenic
1015464542 6:133534026-133534048 ATGGAAATAAAGAACAAGGATGG + Intergenic
1015862266 6:137693136-137693158 CTGGGTCAACAGGCCAAGGAGGG + Intergenic
1016848950 6:148597099-148597121 CTGCAAAACCATAACAAGGATGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1017763124 6:157586231-157586253 CTGGATAAATAAAACAAGGCAGG + Intronic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1019847046 7:3514003-3514025 CTGAATAAAGAGAACATGGTAGG - Intronic
1020048823 7:5066836-5066858 CTGGGTAAACAAAACAAAGATGG + Exonic
1021739829 7:23675518-23675540 CTGAATAAAAAGAACAAAGGTGG - Intergenic
1022289416 7:28986582-28986604 GTGGGTAAAGAGAACAGGGAAGG + Intergenic
1022342866 7:29485578-29485600 GTAGATAAATAGATCAAGGATGG + Intronic
1022424402 7:30254418-30254440 CAAGACAAACAGAACAAGTAGGG - Intergenic
1023634163 7:42193141-42193163 CTAGAGAAACAGCTCAAGGAAGG + Intronic
1025599644 7:62979633-62979655 CAGGATAAAAACAAGAAGGAAGG + Intergenic
1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG + Intergenic
1028907968 7:96175962-96175984 CTGGTTAAACAGGAAAATGAAGG + Intronic
1029835143 7:103301514-103301536 AAGGAGAAACAGAAAAAGGAAGG + Intronic
1030524356 7:110635690-110635712 GTGGATAGACAGTACCAGGAAGG + Intergenic
1031323436 7:120362871-120362893 CAGGGTGAACAGAACCAGGAAGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1032669641 7:134071466-134071488 TTGGGTAAAGGGAACAAGGAGGG + Intergenic
1032860837 7:135877847-135877869 CTGAATAATCAGAGAAAGGAGGG - Intergenic
1032914444 7:136473642-136473664 CTGGAGAAACCTAACAAGGAAGG - Intergenic
1033754925 7:144390447-144390469 CTGGATAAGCAGAGGAAGGAAGG - Intergenic
1034224189 7:149470136-149470158 GTGGATGAGGAGAACAAGGAAGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1037688607 8:21164339-21164361 CTTGGGAAACAGATCAAGGAAGG - Intergenic
1039235869 8:35502232-35502254 CTGGATAAACAGTCCAATGGTGG + Intronic
1039627500 8:39069025-39069047 CTGGCTATAGAGAATAAGGAGGG - Intronic
1041524933 8:58794821-58794843 CTGGAGAAAGAGAAGCAGGAAGG + Intergenic
1041643961 8:60232284-60232306 CTGAACAAACAGAGCAATGATGG + Exonic
1041768134 8:61441994-61442016 CTTGATATACAAAAGAAGGATGG - Intronic
1041863101 8:62536501-62536523 CTGTAGAAACTGAATAAGGAAGG + Intronic
1042143357 8:65702211-65702233 CTGGATAAAGACAACCAGAATGG - Intronic
1042413293 8:68490044-68490066 CTAGAAAAGCAGAACAAGGCCGG - Intronic
1043692641 8:83174676-83174698 TTGGATAAAAACAGCAAGGAAGG - Intergenic
1044394507 8:91694248-91694270 CTGAATAAAAAGAACAAAGCTGG - Intergenic
1046701203 8:117403067-117403089 CTGTTTAGACAGAACAATGAAGG + Intergenic
1046731262 8:117728785-117728807 CAGGAAAAGGAGAACAAGGATGG - Intergenic
1048061217 8:130921019-130921041 CTGGAGAAACAGAACCAACAGGG - Intronic
1049961283 9:740803-740825 GTGGATCACCAGAACAAGGCAGG + Exonic
1050960721 9:11726903-11726925 CAGGAAAGACAGAACAAGGCTGG - Intergenic
1052436395 9:28435691-28435713 CTTGATACACAAAACCAGGAAGG - Intronic
1054362764 9:64193156-64193178 CAGGATAAACACTAGAAGGAAGG + Intergenic
1055819452 9:80244407-80244429 CTGTATAAAGAGAGTAAGGATGG + Intergenic
1056515078 9:87342647-87342669 CTGGAGAAAGAGAAAAAGAAAGG + Intergenic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1057758800 9:97856479-97856501 CTGTATAAACTTAACAGGGAAGG + Exonic
1058145400 9:101405562-101405584 GTGTATATACAGAACAAGTAAGG + Intronic
1058157057 9:101527839-101527861 CTGTATACACACAGCAAGGAGGG - Intronic
1058608700 9:106751921-106751943 CTGGAGAAACAGAGCAGAGAGGG + Intergenic
1058706828 9:107644528-107644550 CTGGATAAACGGAAGAAAGCTGG + Intergenic
1185825385 X:3244271-3244293 ATGGATAAACAGAGGAAGGAAGG + Intergenic
1185939181 X:4295437-4295459 TTGGATAAACAGGACAAGCTTGG - Intergenic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187383073 X:18822944-18822966 CTGAAGAAAAAGAACAAGGTGGG + Intronic
1187553675 X:20331035-20331057 CTGGAAATATAGAACAAGGTAGG - Intergenic
1187755313 X:22518936-22518958 CTGGATAAAGACATCAAGGCAGG + Intergenic
1189797058 X:44655170-44655192 CTAGATAGACTGAACAAAGAGGG + Intergenic
1191265100 X:58380913-58380935 CAGGATAAAAAAGACAAGGACGG - Intergenic
1191268452 X:58429515-58429537 CAGGATAAAAACAAGAAGGAAGG - Intergenic
1192029668 X:67495761-67495783 CTTGATAAAAAGAACCAGAAAGG + Intergenic
1193970439 X:88044474-88044496 CTGAGTAAAAAGAACAAAGATGG + Intergenic
1194943361 X:100039750-100039772 ATAGACAAACAGAACAAGTAAGG + Intergenic
1195009058 X:100717404-100717426 CTGGATAAGCAGGAGAACGAGGG + Intronic
1195708083 X:107752544-107752566 CTGGAGACAAAGAACAAGGAAGG + Intronic
1196600300 X:117594047-117594069 CTAGAGAAAAAGAACAAAGAGGG + Intergenic
1196967774 X:121077109-121077131 ATGCACAAACAAAACAAGGAAGG + Intergenic
1197189341 X:123628470-123628492 CTGGATCAAGAGACCAAGGCGGG + Intronic
1197243628 X:124146151-124146173 ATGCACAAACAGAGCAAGGAAGG + Intronic
1198868731 X:141153713-141153735 CTGGAGAAACAGAGCAAATAGGG + Intergenic
1199387873 X:147243980-147244002 ATGGAGAAAAAGAAGAAGGAAGG - Intergenic
1199888718 X:152051688-152051710 CTGAATAAAAAGAACAAAGCTGG - Intergenic
1200686071 Y:6261103-6261125 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200991607 Y:9352350-9352372 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200994263 Y:9372626-9372648 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1200996927 Y:9392966-9392988 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1200999442 Y:9461518-9461540 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201002097 Y:9481824-9481846 TTGGAGAAACAGAAAAAGGTTGG - Intronic
1201004762 Y:9502110-9502132 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201007415 Y:9522436-9522458 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201010023 Y:9542288-9542310 TTGGAGAAACAGAAAAAGGTTGG - Intergenic
1201253811 Y:12087759-12087781 ATGGATAAACAGAGGAAGGAAGG - Intergenic
1201336308 Y:12884144-12884166 CTAGATTAACAGAACAAGGTGGG - Intergenic
1201945982 Y:19510491-19510513 CTGAACAAACAGAACAAAAAAGG + Intergenic
1202099799 Y:21295284-21295306 CAGGACAGACAGCACAAGGAAGG - Intergenic