ID: 946185491

View in Genome Browser
Species Human (GRCh38)
Location 2:217978549-217978571
Sequence CAGGGGCGGGCTGGGGAATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 473
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 428}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185491_946185514 27 Left 946185491 2:217978549-217978571 CCCGATTCCCCAGCCCGCCCCTG 0: 1
1: 0
2: 3
3: 41
4: 428
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185491_946185499 -9 Left 946185491 2:217978549-217978571 CCCGATTCCCCAGCCCGCCCCTG 0: 1
1: 0
2: 3
3: 41
4: 428
Right 946185499 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG 0: 1
1: 13
2: 52
3: 311
4: 1897
946185491_946185497 -10 Left 946185491 2:217978549-217978571 CCCGATTCCCCAGCCCGCCCCTG 0: 1
1: 0
2: 3
3: 41
4: 428
Right 946185497 2:217978562-217978584 CCCGCCCCTGCCCCCGCCCCCGG 0: 2
1: 18
2: 76
3: 476
4: 2362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185491 Original CRISPR CAGGGGCGGGCTGGGGAATC GGG (reversed) Intronic