ID: 946185492

View in Genome Browser
Species Human (GRCh38)
Location 2:217978550-217978572
Sequence GCAGGGGCGGGCTGGGGAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 712
Summary {0: 1, 1: 0, 2: 2, 3: 75, 4: 634}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185492_946185499 -10 Left 946185492 2:217978550-217978572 CCGATTCCCCAGCCCGCCCCTGC 0: 1
1: 0
2: 2
3: 75
4: 634
Right 946185499 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG 0: 1
1: 13
2: 52
3: 311
4: 1897
946185492_946185514 26 Left 946185492 2:217978550-217978572 CCGATTCCCCAGCCCGCCCCTGC 0: 1
1: 0
2: 2
3: 75
4: 634
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185492 Original CRISPR GCAGGGGCGGGCTGGGGAAT CGG (reversed) Intronic