ID: 946185493

View in Genome Browser
Species Human (GRCh38)
Location 2:217978556-217978578
Sequence GCGGGGGCAGGGGCGGGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2495
Summary {0: 1, 1: 0, 2: 33, 3: 301, 4: 2160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185493_946185514 20 Left 946185493 2:217978556-217978578 CCCCAGCCCGCCCCTGCCCCCGC 0: 1
1: 0
2: 33
3: 301
4: 2160
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185493_946185516 26 Left 946185493 2:217978556-217978578 CCCCAGCCCGCCCCTGCCCCCGC 0: 1
1: 0
2: 33
3: 301
4: 2160
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185493 Original CRISPR GCGGGGGCAGGGGCGGGCTG GGG (reversed) Intronic
Too many off-targets to display for this crispr