ID: 946185494

View in Genome Browser
Species Human (GRCh38)
Location 2:217978557-217978579
Sequence GGCGGGGGCAGGGGCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2744
Summary {0: 1, 1: 2, 2: 36, 3: 418, 4: 2287}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185494_946185514 19 Left 946185494 2:217978557-217978579 CCCAGCCCGCCCCTGCCCCCGCC 0: 1
1: 2
2: 36
3: 418
4: 2287
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185494_946185516 25 Left 946185494 2:217978557-217978579 CCCAGCCCGCCCCTGCCCCCGCC 0: 1
1: 2
2: 36
3: 418
4: 2287
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185494 Original CRISPR GGCGGGGGCAGGGGCGGGCT GGG (reversed) Intronic