ID: 946185495

View in Genome Browser
Species Human (GRCh38)
Location 2:217978558-217978580
Sequence GGGCGGGGGCAGGGGCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4507
Summary {0: 2, 1: 11, 2: 106, 3: 606, 4: 3782}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185495_946185516 24 Left 946185495 2:217978558-217978580 CCAGCCCGCCCCTGCCCCCGCCC 0: 2
1: 11
2: 106
3: 606
4: 3782
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185495_946185514 18 Left 946185495 2:217978558-217978580 CCAGCCCGCCCCTGCCCCCGCCC 0: 2
1: 11
2: 106
3: 606
4: 3782
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185495 Original CRISPR GGGCGGGGGCAGGGGCGGGC TGG (reversed) Intronic