ID: 946185496

View in Genome Browser
Species Human (GRCh38)
Location 2:217978562-217978584
Sequence CCGGGGGCGGGGGCAGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5611
Summary {0: 1, 1: 16, 2: 214, 3: 933, 4: 4447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185496_946185516 20 Left 946185496 2:217978562-217978584 CCCGCCCCTGCCCCCGCCCCCGG 0: 1
1: 16
2: 214
3: 933
4: 4447
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185496_946185514 14 Left 946185496 2:217978562-217978584 CCCGCCCCTGCCCCCGCCCCCGG 0: 1
1: 16
2: 214
3: 933
4: 4447
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185496 Original CRISPR CCGGGGGCGGGGGCAGGGGC GGG (reversed) Intronic