ID: 946185498

View in Genome Browser
Species Human (GRCh38)
Location 2:217978563-217978585
Sequence CCCGGGGGCGGGGGCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3561
Summary {0: 1, 1: 10, 2: 63, 3: 572, 4: 2915}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185498_946185514 13 Left 946185498 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG 0: 1
1: 10
2: 63
3: 572
4: 2915
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185498_946185516 19 Left 946185498 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG 0: 1
1: 10
2: 63
3: 572
4: 2915
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185498 Original CRISPR CCCGGGGGCGGGGGCAGGGG CGG (reversed) Intronic