ID: 946185501

View in Genome Browser
Species Human (GRCh38)
Location 2:217978567-217978589
Sequence AAGGCCCGGGGGCGGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 897
Summary {0: 1, 1: 0, 2: 4, 3: 95, 4: 797}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185501_946185516 15 Left 946185501 2:217978567-217978589 CCCTGCCCCCGCCCCCGGGCCTT 0: 1
1: 0
2: 4
3: 95
4: 797
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185501_946185514 9 Left 946185501 2:217978567-217978589 CCCTGCCCCCGCCCCCGGGCCTT 0: 1
1: 0
2: 4
3: 95
4: 797
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185501 Original CRISPR AAGGCCCGGGGGCGGGGGCA GGG (reversed) Intronic