ID: 946185502

View in Genome Browser
Species Human (GRCh38)
Location 2:217978568-217978590
Sequence GAAGGCCCGGGGGCGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1565
Summary {0: 1, 1: 0, 2: 22, 3: 156, 4: 1386}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185502_946185514 8 Left 946185502 2:217978568-217978590 CCTGCCCCCGCCCCCGGGCCTTC 0: 1
1: 0
2: 22
3: 156
4: 1386
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185502_946185516 14 Left 946185502 2:217978568-217978590 CCTGCCCCCGCCCCCGGGCCTTC 0: 1
1: 0
2: 22
3: 156
4: 1386
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185502 Original CRISPR GAAGGCCCGGGGGCGGGGGC AGG (reversed) Intronic