ID: 946185503

View in Genome Browser
Species Human (GRCh38)
Location 2:217978572-217978594
Sequence AGGCGAAGGCCCGGGGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 549
Summary {0: 1, 1: 0, 2: 1, 3: 44, 4: 503}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185503_946185514 4 Left 946185503 2:217978572-217978594 CCCCCGCCCCCGGGCCTTCGCCT 0: 1
1: 0
2: 1
3: 44
4: 503
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185503_946185516 10 Left 946185503 2:217978572-217978594 CCCCCGCCCCCGGGCCTTCGCCT 0: 1
1: 0
2: 1
3: 44
4: 503
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185503 Original CRISPR AGGCGAAGGCCCGGGGGCGG GGG (reversed) Intronic