ID: 946185505

View in Genome Browser
Species Human (GRCh38)
Location 2:217978574-217978596
Sequence GAAGGCGAAGGCCCGGGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 3, 3: 39, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185505_946185514 2 Left 946185505 2:217978574-217978596 CCCGCCCCCGGGCCTTCGCCTTC 0: 1
1: 0
2: 3
3: 39
4: 358
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185505_946185516 8 Left 946185505 2:217978574-217978596 CCCGCCCCCGGGCCTTCGCCTTC 0: 1
1: 0
2: 3
3: 39
4: 358
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185505 Original CRISPR GAAGGCGAAGGCCCGGGGGC GGG (reversed) Intronic