ID: 946185506

View in Genome Browser
Species Human (GRCh38)
Location 2:217978575-217978597
Sequence TGAAGGCGAAGGCCCGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 230}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185506_946185514 1 Left 946185506 2:217978575-217978597 CCGCCCCCGGGCCTTCGCCTTCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185506_946185516 7 Left 946185506 2:217978575-217978597 CCGCCCCCGGGCCTTCGCCTTCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185506_946185523 30 Left 946185506 2:217978575-217978597 CCGCCCCCGGGCCTTCGCCTTCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185506 Original CRISPR TGAAGGCGAAGGCCCGGGGG CGG (reversed) Intronic