ID: 946185506 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:217978575-217978597 |
Sequence | TGAAGGCGAAGGCCCGGGGG CGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 253 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 22, 4: 230} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946185506_946185523 | 30 | Left | 946185506 | 2:217978575-217978597 | CCGCCCCCGGGCCTTCGCCTTCA | 0: 1 1: 0 2: 0 3: 22 4: 230 |
||
Right | 946185523 | 2:217978628-217978650 | CGCTTTGCATAAACAAAGAGAGG | 0: 1 1: 0 2: 0 3: 7 4: 98 |
||||
946185506_946185516 | 7 | Left | 946185506 | 2:217978575-217978597 | CCGCCCCCGGGCCTTCGCCTTCA | 0: 1 1: 0 2: 0 3: 22 4: 230 |
||
Right | 946185516 | 2:217978605-217978627 | CTGCGCCCGCTCCCAGGCCCAGG | 0: 1 1: 0 2: 7 3: 54 4: 539 |
||||
946185506_946185514 | 1 | Left | 946185506 | 2:217978575-217978597 | CCGCCCCCGGGCCTTCGCCTTCA | 0: 1 1: 0 2: 0 3: 22 4: 230 |
||
Right | 946185514 | 2:217978599-217978621 | CTTGACCTGCGCCCGCTCCCAGG | 0: 1 1: 0 2: 0 3: 23 4: 179 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946185506 | Original CRISPR | TGAAGGCGAAGGCCCGGGGG CGG (reversed) | Intronic | ||