ID: 946185508

View in Genome Browser
Species Human (GRCh38)
Location 2:217978579-217978601
Sequence AAGGTGAAGGCGAAGGCCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185508_946185524 29 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185524 2:217978631-217978653 TTTGCATAAACAAAGAGAGGAGG 0: 1
1: 0
2: 1
3: 35
4: 373
946185508_946185516 3 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185508_946185523 26 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185508_946185514 -3 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185508 Original CRISPR AAGGTGAAGGCGAAGGCCCG GGG (reversed) Intronic