ID: 946185510

View in Genome Browser
Species Human (GRCh38)
Location 2:217978581-217978603
Sequence TCAAGGTGAAGGCGAAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 224}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185510_946185516 1 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185510_946185514 -5 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185510_946185523 24 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185510_946185524 27 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185524 2:217978631-217978653 TTTGCATAAACAAAGAGAGGAGG 0: 1
1: 0
2: 1
3: 35
4: 373
946185510_946185525 30 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185510 Original CRISPR TCAAGGTGAAGGCGAAGGCC CGG (reversed) Intronic