ID: 946185511

View in Genome Browser
Species Human (GRCh38)
Location 2:217978586-217978608
Sequence GCAGGTCAAGGTGAAGGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 328}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185511_946185525 25 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185511_946185514 -10 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185511_946185524 22 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185524 2:217978631-217978653 TTTGCATAAACAAAGAGAGGAGG 0: 1
1: 0
2: 1
3: 35
4: 373
946185511_946185516 -4 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185511_946185523 19 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185511_946185526 26 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185526 2:217978635-217978657 CATAAACAAAGAGAGGAGGAGGG 0: 1
1: 0
2: 1
3: 73
4: 1080

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185511 Original CRISPR GCAGGTCAAGGTGAAGGCGA AGG (reversed) Intronic