ID: 946185512

View in Genome Browser
Species Human (GRCh38)
Location 2:217978592-217978614
Sequence GCGGGCGCAGGTCAAGGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 150}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185512_946185527 29 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185527 2:217978644-217978666 AGAGAGGAGGAGGGACGCCCCGG 0: 1
1: 0
2: 4
3: 49
4: 544
946185512_946185526 20 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185526 2:217978635-217978657 CATAAACAAAGAGAGGAGGAGGG 0: 1
1: 0
2: 1
3: 73
4: 1080
946185512_946185516 -10 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185512_946185523 13 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185512_946185528 30 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185512_946185524 16 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185524 2:217978631-217978653 TTTGCATAAACAAAGAGAGGAGG 0: 1
1: 0
2: 1
3: 35
4: 373
946185512_946185525 19 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185512 Original CRISPR GCGGGCGCAGGTCAAGGTGA AGG (reversed) Intronic