ID: 946185514

View in Genome Browser
Species Human (GRCh38)
Location 2:217978599-217978621
Sequence CTTGACCTGCGCCCGCTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 179}

Found 21 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185511_946185514 -10 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185503_946185514 4 Left 946185503 2:217978572-217978594 CCCCCGCCCCCGGGCCTTCGCCT 0: 1
1: 0
2: 1
3: 44
4: 503
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185501_946185514 9 Left 946185501 2:217978567-217978589 CCCTGCCCCCGCCCCCGGGCCTT 0: 1
1: 0
2: 4
3: 95
4: 797
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185491_946185514 27 Left 946185491 2:217978549-217978571 CCCGATTCCCCAGCCCGCCCCTG 0: 1
1: 0
2: 3
3: 41
4: 428
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185490_946185514 28 Left 946185490 2:217978548-217978570 CCCCGATTCCCCAGCCCGCCCCT 0: 1
1: 0
2: 2
3: 18
4: 285
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185502_946185514 8 Left 946185502 2:217978568-217978590 CCTGCCCCCGCCCCCGGGCCTTC 0: 1
1: 0
2: 22
3: 156
4: 1386
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185510_946185514 -5 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185492_946185514 26 Left 946185492 2:217978550-217978572 CCGATTCCCCAGCCCGCCCCTGC 0: 1
1: 0
2: 2
3: 75
4: 634
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185498_946185514 13 Left 946185498 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG 0: 1
1: 10
2: 63
3: 572
4: 2915
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185495_946185514 18 Left 946185495 2:217978558-217978580 CCAGCCCGCCCCTGCCCCCGCCC 0: 2
1: 11
2: 106
3: 606
4: 3782
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185493_946185514 20 Left 946185493 2:217978556-217978578 CCCCAGCCCGCCCCTGCCCCCGC 0: 1
1: 0
2: 33
3: 301
4: 2160
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185504_946185514 3 Left 946185504 2:217978573-217978595 CCCCGCCCCCGGGCCTTCGCCTT 0: 1
1: 0
2: 0
3: 19
4: 231
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185507_946185514 -2 Left 946185507 2:217978578-217978600 CCCCCGGGCCTTCGCCTTCACCT 0: 1
1: 0
2: 2
3: 11
4: 179
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185489_946185514 29 Left 946185489 2:217978547-217978569 CCCCCGATTCCCCAGCCCGCCCC 0: 1
1: 0
2: 1
3: 36
4: 484
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185496_946185514 14 Left 946185496 2:217978562-217978584 CCCGCCCCTGCCCCCGCCCCCGG 0: 1
1: 16
2: 214
3: 933
4: 4447
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185506_946185514 1 Left 946185506 2:217978575-217978597 CCGCCCCCGGGCCTTCGCCTTCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185508_946185514 -3 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185500_946185514 10 Left 946185500 2:217978566-217978588 CCCCTGCCCCCGCCCCCGGGCCT 0: 1
1: 0
2: 22
3: 238
4: 1961
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185509_946185514 -4 Left 946185509 2:217978580-217978602 CCCGGGCCTTCGCCTTCACCTTG 0: 1
1: 0
2: 2
3: 31
4: 240
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185494_946185514 19 Left 946185494 2:217978557-217978579 CCCAGCCCGCCCCTGCCCCCGCC 0: 1
1: 2
2: 36
3: 418
4: 2287
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179
946185505_946185514 2 Left 946185505 2:217978574-217978596 CCCGCCCCCGGGCCTTCGCCTTC 0: 1
1: 0
2: 3
3: 39
4: 358
Right 946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG 0: 1
1: 0
2: 0
3: 23
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185514 Original CRISPR CTTGACCTGCGCCCGCTCCC AGG Intronic
901020181 1:6251404-6251426 CTGGGCCTGCGACCGCTACCGGG - Exonic
901361306 1:8703227-8703249 CGGGACCTGCGCCCGCGCCGCGG - Intronic
902144688 1:14388194-14388216 CCTGACCTGCGCCCACTGTCTGG + Intergenic
904616625 1:31753542-31753564 CTTGTCCTGGCCCCTCTCCCAGG - Intronic
907631731 1:56089763-56089785 ACTGACCTGCGCCCACTGCCTGG - Intergenic
908575611 1:65456162-65456184 ATTGACCTGCGCCCACTGTCTGG + Intronic
909412973 1:75375949-75375971 ACTGACCTGCGCCCACTGCCTGG - Intronic
909441147 1:75697764-75697786 ACTGACCTGCGCCCACTCTCTGG - Intergenic
910539695 1:88341965-88341987 ACTGACCTGCGCCCGCTGTCTGG - Intergenic
911359493 1:96859215-96859237 ACTGACCTGCGCCCGCTGTCTGG + Intergenic
916586211 1:166152590-166152612 TTTAACCTGTGCCCTCTCCCTGG + Intronic
919759048 1:201085551-201085573 CTTGGCCTTCTCCCGCTCCTTGG + Exonic
923334694 1:232958021-232958043 CTTCACCTGCTCCTGCTCCAGGG - Intronic
924888902 1:248252985-248253007 ACTGACCTGCGCCCGCTGTCTGG - Intergenic
1063665156 10:8056269-8056291 CTTGTCCGGCGCCGGCTACCGGG - Intronic
1073064487 10:100750123-100750145 CTTGCCCTGCCCCTGGTCCCTGG + Intronic
1074971625 10:118543971-118543993 CTTGGCCTCCTCCCGCCCCCCGG - Intergenic
1075785610 10:125048191-125048213 CTTGGGCTGGGCCAGCTCCCAGG - Intronic
1076558786 10:131347376-131347398 CTTGACTTGGGCCTGGTCCCCGG - Intergenic
1077097200 11:804103-804125 CCTGTCCTGCCTCCGCTCCCTGG - Exonic
1077143918 11:1036444-1036466 CGTGACCAGCCCCCGCTGCCAGG - Intronic
1077976258 11:7251844-7251866 CCTGACCTGGCCCCGCCCCCCGG + Intronic
1079618917 11:22529068-22529090 ACTGACCTGCGCCCACTCTCTGG + Intergenic
1080968918 11:37246570-37246592 ACTGACCTGCGCCCGCTATCTGG + Intergenic
1081759891 11:45569867-45569889 CCTGACCTCCGTCCGCTTCCTGG - Intergenic
1082810477 11:57476503-57476525 CGTGACCTGCGCCACCCCCCCGG + Exonic
1083309410 11:61776735-61776757 CATGGCCTGCCCCCGCCCCCAGG - Intronic
1084363704 11:68684710-68684732 CTTGAGCTGCGGCTGCGCCCGGG - Exonic
1091791231 12:3273370-3273392 CTGGACCTGCACCTGCTCCGGGG + Intronic
1092829905 12:12433690-12433712 CTTGACCTGAACCTGCTTCCAGG - Intronic
1095979570 12:47963777-47963799 CGTGACCTGAGCCCGCCTCCTGG + Intronic
1096560672 12:52433843-52433865 CTTGATCTGCTCGCGCTCCTCGG + Exonic
1096563151 12:52451575-52451597 CTTGATCTGCTCACGCTCCTCGG + Exonic
1096565302 12:52473234-52473256 CTTGATCTGCTCACGCTCCTCGG + Exonic
1096570370 12:52519778-52519800 CTTGATCTGCTCGCGCTCCTCGG + Exonic
1096575879 12:52552673-52552695 CTTGATCTGCTCTCGCTCCTGGG + Exonic
1096579147 12:52573343-52573365 CTTGATCTGTTCCCGCTCCTGGG + Exonic
1096583085 12:52601063-52601085 CTTGATCTGCTCCCGCTCCTGGG + Exonic
1096585663 12:52618114-52618136 CTTGATCTGCTCCCGCTCCTGGG + Exonic
1096599748 12:52721177-52721199 CTTGATCTGCTCCCGCTTCTGGG + Intergenic
1096607401 12:52776728-52776750 CTTGATCTGTTCCCGCTCCTGGG + Exonic
1096610081 12:52795434-52795456 CTTGATCTGTTCCCGCTCCTGGG + Exonic
1097269673 12:57766249-57766271 CTTGACCTGTGCCCACGCCAAGG + Intronic
1097712496 12:62932487-62932509 CTTGACAGGCGCCCTCGCCCTGG + Intronic
1098181316 12:67849681-67849703 ACTGACCTGCGCCCACTCTCTGG + Intergenic
1098615802 12:72520521-72520543 ACTGACCTGCGCCCACTCTCTGG + Intronic
1103890663 12:124236727-124236749 CCTGTCCTGTGCCCACTCCCCGG + Intronic
1104977992 12:132560674-132560696 CCTGACCTCCGCCCGCCGCCGGG + Intronic
1106157235 13:27171013-27171035 CTTGACTTCCGTCCTCTCCCAGG + Intronic
1107779038 13:43879299-43879321 GCCGCCCTGCGCCCGCTCCCAGG + Exonic
1113887800 13:113670167-113670189 CTTCACCAGCGCCCACTCCTAGG + Intronic
1113979727 13:114264436-114264458 CTAGCCCTGCGCCCGGTCCCAGG + Intronic
1114459155 14:22875908-22875930 CTAGGCCTTCGCCAGCTCCCAGG - Exonic
1116524601 14:45889112-45889134 CTGGACCTGCGCCCACTGTCTGG + Intergenic
1121884117 14:97527283-97527305 GTTAACCTGAGCCTGCTCCCAGG + Intergenic
1122037512 14:98959629-98959651 CTTGACCTGCCCACACTGCCCGG + Intergenic
1123425211 15:20165148-20165170 CTTGACCTGTGGCCTCTCCCAGG + Intergenic
1123534435 15:21171682-21171704 CTTGACCTGTGGCCTCTCCCAGG + Intergenic
1128269220 15:66293851-66293873 CGCGGCCTGCGCCCGCTCGCCGG + Intronic
1129172574 15:73817140-73817162 CCTGACCCCCGCCCACTCCCCGG - Intergenic
1129741354 15:77991178-77991200 CTTTACCTGCACCGGCTCCTGGG + Intronic
1132273185 15:100544421-100544443 CTTGACCTGCGCGGGGTCACGGG + Intronic
1132828992 16:1918440-1918462 CCCGCCCCGCGCCCGCTCCCAGG - Exonic
1134104797 16:11477788-11477810 CCTAACCTGCGCCAGCTCCCAGG + Intronic
1136783077 16:32919218-32919240 CTTGACTTGCGCCCTCTGGCTGG + Intergenic
1136859650 16:33690595-33690617 CTTGACCTGTGGCCTCTCCCAGG - Intergenic
1136992182 16:35160278-35160300 ACTGACCTGCGCCCGCTGTCTGG - Intergenic
1137879164 16:52028862-52028884 CTTCACCTGAGCCCTCTCCATGG + Intronic
1139050550 16:63120074-63120096 CCTGACCTGCGCCCACTGTCTGG - Intergenic
1139649712 16:68356199-68356221 CCTGACCTGCTTCAGCTCCCAGG - Intronic
1140753824 16:78049610-78049632 CTTGACCTGCTCCTTCTCCTGGG + Intronic
1141219798 16:82058863-82058885 CTTGCCCTGTACTCGCTCCCTGG - Intronic
1141228204 16:82139369-82139391 ATTGACCTGCGCCCACTGCCTGG - Intergenic
1203085727 16_KI270728v1_random:1183203-1183225 CTTGACTTGCGCCCTCTGGCTGG + Intergenic
1203121156 16_KI270728v1_random:1538774-1538796 CTTGACCTGTGGCCTCTCCCAGG - Intergenic
1143473793 17:7191903-7191925 CTTCATCCGCCCCCGCTCCCTGG - Exonic
1143711975 17:8741679-8741701 CCTGACCAGCGCCACCTCCCCGG - Intronic
1145196200 17:20896597-20896619 CTTGGCCTGCGCCCGGAGCCAGG + Intergenic
1145241905 17:21245095-21245117 CTTCACCTGCCCCCATTCCCTGG - Intronic
1145724478 17:27105030-27105052 ACTGACCTGCGCCCGCTGTCTGG + Intergenic
1146062833 17:29615985-29616007 CTGGACGTGCGCCCGCCCTCCGG - Exonic
1147143336 17:38471399-38471421 CTTGACTTGCGCCCTCTGGCTGG + Intronic
1152104256 17:78319462-78319484 CTTGACCTCTGCCCTCTCCTGGG + Intergenic
1152598540 17:81249925-81249947 CCAGACCTGCGCACGCACCCAGG - Intronic
1152614288 17:81330768-81330790 CCTGGCCTGTGCCTGCTCCCTGG - Intergenic
1153706032 18:7746923-7746945 CTTTACCTCTGCCCTCTCCCTGG - Intronic
1155549352 18:26948819-26948841 CTTGTCCTGCCCCAACTCCCTGG - Intronic
1160967630 19:1753578-1753600 CATGACTCCCGCCCGCTCCCCGG - Exonic
1162907043 19:13830333-13830355 CTGGGCCTGCGCCCGCACCCTGG + Exonic
1166377502 19:42335954-42335976 CGTGGCCTGGGCCGGCTCCCTGG + Exonic
1166441077 19:42815980-42816002 CTTGACCTGCATCCCCACCCTGG + Intronic
1166894762 19:46016428-46016450 CCTGGCCCGTGCCCGCTCCCGGG + Intronic
1167626835 19:50595916-50595938 CTTGTCCTTCTCCCTCTCCCTGG + Intergenic
1167792069 19:51689231-51689253 CTGGACCTGGGCCAGCTCCGGGG + Intergenic
1168125198 19:54278961-54278983 CGTGACCTTCGCCAGCTCCCTGG - Exonic
925012700 2:497405-497427 TTAGTCCTGCGCCCCCTCCCTGG - Intergenic
926978358 2:18537818-18537840 CTTGATCTACGCCAGCTCTCAGG - Intergenic
929291450 2:40196647-40196669 CTAGACCTGCACCTACTCCCAGG + Intronic
929798137 2:45075870-45075892 ACTGACCTGCGCCCACTCTCTGG - Intergenic
929874034 2:45781629-45781651 CTCCACCCGCGCCCGCCCCCCGG + Intronic
934458010 2:94191705-94191727 CTTGACCTGTGGCCTCTCCCAGG - Intergenic
934553897 2:95277521-95277543 CCTGAGCTGGGCCCGCACCCTGG + Exonic
935643114 2:105309240-105309262 CCTGCCCTGCTCCCGCTCACAGG - Intronic
936029932 2:109062848-109062870 CTTCACCTCCACCCGCTCCCAGG - Intergenic
936932423 2:117803911-117803933 ACTGACCTGCGCCCACTCTCTGG - Intergenic
936980208 2:118256770-118256792 CTTGAACTGGGCTGGCTCCCTGG - Intergenic
938408227 2:131044504-131044526 CTGCACCTGCTCCCTCTCCCTGG - Exonic
945121700 2:206463722-206463744 CCTGACCTGCCCCTGATCCCGGG - Intronic
946185514 2:217978599-217978621 CTTGACCTGCGCCCGCTCCCAGG + Intronic
947290453 2:228568383-228568405 ACTGACCTGCGCCCGCTGTCTGG - Intergenic
1169496722 20:6122856-6122878 CTTCGCCAGCGCCCGCTCCTCGG - Exonic
1170572584 20:17640936-17640958 CTCCCCCTGCGCCCGCTGCCCGG + Intronic
1175512238 20:59537657-59537679 ACTGACCTGCGCCCGCTGTCTGG + Intergenic
1176158861 20:63638403-63638425 CCTGACTTGCCCACGCTCCCTGG + Intergenic
1180044706 21:45299938-45299960 CTTGTCCTGAGCCCCCACCCAGG - Intergenic
1180051839 21:45335178-45335200 CCAGACCTGTGCCCCCTCCCCGG + Intergenic
1180051856 21:45335216-45335238 CCAGACCTGTGCCCCCTCCCAGG + Intergenic
1180051918 21:45335365-45335387 CCGGACCTGTGCCCCCTCCCTGG + Intergenic
1180051979 21:45335516-45335538 CCAGACCTGTGCCCCCTCCCCGG + Intergenic
1180129982 21:45821152-45821174 CTTGACCTGCTCCCCCTTCCCGG + Intronic
1181978381 22:26748928-26748950 CTTGGCCTCCTCCCTCTCCCTGG + Intergenic
1183309448 22:37101543-37101565 CTTGCCCAGCGCCCAGTCCCAGG + Intronic
1183509681 22:38227466-38227488 CCTCACCTGCGCCGGCTTCCCGG - Intronic
1184155210 22:42662594-42662616 CGTCACCTCCTCCCGCTCCCGGG - Intergenic
1184276823 22:43413321-43413343 CCTGACCCGCCCCCGCCCCCCGG - Intronic
1184476996 22:44727327-44727349 CCTCACCTGACCCCGCTCCCAGG - Intronic
1184774790 22:46617751-46617773 TTAGCCCTGGGCCCGCTCCCTGG + Intronic
950553511 3:13681681-13681703 GTGGTCCTGCACCCGCTCCCAGG - Intergenic
952451727 3:33439925-33439947 CTTCACCCGCGCCCTCCCCCAGG - Exonic
952901015 3:38111828-38111850 CTGGTCCTGGTCCCGCTCCCTGG - Intronic
954890958 3:53927658-53927680 ACTGACCTGCGCCCACTCTCTGG + Intergenic
955014194 3:55051984-55052006 CATGACCTGCGCCCACTGTCTGG + Intronic
955026281 3:55170964-55170986 CTTGTCTTGCTCCTGCTCCCAGG + Intergenic
959353358 3:105296347-105296369 ACTGACCTGCGCCCGCTGTCTGG - Intergenic
966880073 3:184345160-184345182 CATGTCCTGCCCCCACTCCCGGG + Exonic
967238432 3:187412248-187412270 ACTGACCTGCGCCCACTCTCTGG - Intergenic
968084381 3:195867922-195867944 CTGGACCTGCTTCCCCTCCCCGG - Exonic
968382331 4:107574-107596 CTTGTCCTCCTCCCGCTCCCGGG + Intergenic
968946854 4:3669354-3669376 CTGGAGCAGCGCCCTCTCCCTGG - Intergenic
969370641 4:6729049-6729071 CATGGCCTGCCCCCCCTCCCTGG - Intergenic
971181149 4:24329517-24329539 CTTGTGCTGCGCCCTCCCCCTGG + Intergenic
973549690 4:52021184-52021206 ATGTACCTGCGCCCCCTCCCGGG + Exonic
981222469 4:142253466-142253488 ACTGACCTGCGCCCACTCTCTGG - Intronic
982511712 4:156290467-156290489 ACTGACCTGCGCCCACTCTCTGG + Intergenic
982581220 4:157180770-157180792 ACTGACCTGCGCCCACTCTCTGG + Intergenic
985645775 5:1084106-1084128 CCTGGCCTGGGCCCGGTCCCTGG - Intronic
987482038 5:18471941-18471963 ACTGACCTGCGCCCACTCTCTGG - Intergenic
990382896 5:55233366-55233388 CTGAACCCGTGCCCGCTCCCGGG - Exonic
997395252 5:133554472-133554494 CTTCATCTGCTCCCTCTCCCAGG + Intronic
1002140354 5:177133930-177133952 CGTGCCCCGCGCCCCCTCCCGGG - Exonic
1002447070 5:179296274-179296296 CTTGAGCTCCGGCTGCTCCCGGG - Intronic
1202775217 5_GL000208v1_random:63326-63348 ATTGACCTGCGCCCACTGTCTGG + Intergenic
1003414038 6:5892270-5892292 ACTGACCTGCGCCCGCTCTCTGG + Intergenic
1005838282 6:29723937-29723959 CGTGACCTGCGCCCCCGGCCGGG - Intronic
1005866752 6:29943036-29943058 CCTGACCTGCGCCCCCGGCCGGG - Intronic
1006411811 6:33878216-33878238 CTTGAGCTGCGTCTGTTCCCTGG + Intergenic
1007752113 6:44076978-44077000 TCTGACCTGCGCCCCTTCCCTGG + Intergenic
1008671162 6:53770472-53770494 CTTTCCCTGCCTCCGCTCCCAGG + Intergenic
1010526503 6:76906082-76906104 ACTGACCTGCGCCCACTCTCTGG + Intergenic
1015642597 6:135351850-135351872 CTGGACCTGCGCCTCCTTCCTGG + Intronic
1018126275 6:160685604-160685626 ACTGACCTGCGCCCGCTGTCTGG + Intergenic
1018669558 6:166167702-166167724 CGAGACCTGCGACGGCTCCCGGG + Exonic
1018950257 6:168374335-168374357 CTGGACCTGAGCCAGCCCCCCGG - Intergenic
1020106987 7:5426779-5426801 CGTGATCTTCGCCCGCTCCCCGG + Intergenic
1020125156 7:5529485-5529507 CTTGCCTCCCGCCCGCTCCCGGG + Intronic
1022506655 7:30911875-30911897 CTTGGCCTGAGACCGCTGCCGGG - Exonic
1026869539 7:73842090-73842112 CCTGACCCGCGCCCGCACCTCGG + Exonic
1027924717 7:84446850-84446872 CCTGACCTCCGCCAGCTCCACGG - Intronic
1028252883 7:88556919-88556941 CCTGACCTGCGCCCACTGTCTGG + Intergenic
1030270139 7:107661396-107661418 CGTGGCCTGCACCCGCTGCCCGG - Intronic
1035792866 8:2323592-2323614 ATTGACCTGCGCCCACTGTCTGG + Intergenic
1035799938 8:2398113-2398135 ATTGACCTGCGCCCACTGTCTGG - Intergenic
1041355318 8:56993689-56993711 CTACACTGGCGCCCGCTCCCCGG + Exonic
1041371411 8:57164509-57164531 ACTGACCTGCGCCCGCTGTCTGG + Intergenic
1044030497 8:87229129-87229151 ACTGACCTGCGCCCGCTGTCTGG + Intronic
1044045480 8:87426198-87426220 ACTGACCTGCGCCCGCTGTCTGG + Intronic
1044666527 8:94639425-94639447 CCTGGCCTTCGCCCGCTCTCAGG + Intergenic
1044746430 8:95375588-95375610 ACTGACCTGCGCCCACTGCCTGG + Intergenic
1045386717 8:101678195-101678217 ACTGACCTGCGCCCACTGCCTGG - Intergenic
1046812549 8:118548662-118548684 ACTGACCTGCGCCCACTCTCTGG - Intronic
1046871391 8:119208722-119208744 TTTGTCCTGCGCTCCCTCCCGGG + Intronic
1048190336 8:132282537-132282559 CTTGCTCTGCTCCCGCCCCCTGG + Intronic
1048333997 8:133489793-133489815 CTTGACCACCGCCCACTCCTGGG + Intronic
1049237257 8:141518556-141518578 CCTGAGCTGCGCCCGCGCGCGGG + Exonic
1049741332 8:144242445-144242467 CTTGGCCAGCACCAGCTCCCGGG - Exonic
1053688521 9:40567510-40567532 CTTGACCTGTGGCCTCTCCCAGG - Intergenic
1054275511 9:63063548-63063570 CTTGACCTGTGGCCTCTCCCAGG + Intergenic
1054299760 9:63368421-63368443 CTTGACCTGTGGCCTCTCCCAGG - Intergenic
1054399322 9:64701383-64701405 CTTGACCTGTGGCCTCTCCCAGG - Intergenic
1054432902 9:65185648-65185670 CTTGACCTGTGGCCTCTCCCAGG - Intergenic
1054497483 9:65836027-65836049 CTTGACCTGTGGCCTCTCCCAGG + Intergenic
1060629516 9:125143318-125143340 CTGCCCCTGGGCCCGCTCCCTGG + Intronic
1061883404 9:133579004-133579026 TGTGACCTGGGCCCGCCCCCGGG - Exonic
1062346920 9:136119183-136119205 CCAGACCTGCTCCCGGTCCCTGG - Intergenic
1203353893 Un_KI270442v1:113717-113739 ACTGACCTGCGCCCACTGCCTGG - Intergenic
1192365953 X:70473330-70473352 CTTCACCAGCGCCCTTTCCCTGG + Intronic
1193522927 X:82552425-82552447 ACTGACCTGCGCCCACTCTCTGG + Intergenic
1195259147 X:103115826-103115848 CTTGACCTGCACCATCTCACTGG - Intergenic
1199977829 X:152904778-152904800 TTTGACCTTAGCCCCCTCCCCGG + Intergenic
1200115180 X:153766851-153766873 CCTGACCTGTGCCCTCTCACAGG + Exonic
1200218255 X:154378379-154378401 CTTGCCCTGCAGCCGCTTCCCGG + Intergenic
1201360039 Y:13136377-13136399 ACTGACCTGCGCCCACTCTCTGG + Intergenic
1201936783 Y:19418876-19418898 ACTGACCTGCGCCCGCTGTCTGG + Intergenic