ID: 946185516

View in Genome Browser
Species Human (GRCh38)
Location 2:217978605-217978627
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 539}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185496_946185516 20 Left 946185496 2:217978562-217978584 CCCGCCCCTGCCCCCGCCCCCGG 0: 1
1: 16
2: 214
3: 933
4: 4447
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185509_946185516 2 Left 946185509 2:217978580-217978602 CCCGGGCCTTCGCCTTCACCTTG 0: 1
1: 0
2: 2
3: 31
4: 240
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185495_946185516 24 Left 946185495 2:217978558-217978580 CCAGCCCGCCCCTGCCCCCGCCC 0: 2
1: 11
2: 106
3: 606
4: 3782
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185506_946185516 7 Left 946185506 2:217978575-217978597 CCGCCCCCGGGCCTTCGCCTTCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185504_946185516 9 Left 946185504 2:217978573-217978595 CCCCGCCCCCGGGCCTTCGCCTT 0: 1
1: 0
2: 0
3: 19
4: 231
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185493_946185516 26 Left 946185493 2:217978556-217978578 CCCCAGCCCGCCCCTGCCCCCGC 0: 1
1: 0
2: 33
3: 301
4: 2160
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185494_946185516 25 Left 946185494 2:217978557-217978579 CCCAGCCCGCCCCTGCCCCCGCC 0: 1
1: 2
2: 36
3: 418
4: 2287
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185501_946185516 15 Left 946185501 2:217978567-217978589 CCCTGCCCCCGCCCCCGGGCCTT 0: 1
1: 0
2: 4
3: 95
4: 797
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185511_946185516 -4 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185512_946185516 -10 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185498_946185516 19 Left 946185498 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG 0: 1
1: 10
2: 63
3: 572
4: 2915
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185503_946185516 10 Left 946185503 2:217978572-217978594 CCCCCGCCCCCGGGCCTTCGCCT 0: 1
1: 0
2: 1
3: 44
4: 503
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185505_946185516 8 Left 946185505 2:217978574-217978596 CCCGCCCCCGGGCCTTCGCCTTC 0: 1
1: 0
2: 3
3: 39
4: 358
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185508_946185516 3 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185510_946185516 1 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185502_946185516 14 Left 946185502 2:217978568-217978590 CCTGCCCCCGCCCCCGGGCCTTC 0: 1
1: 0
2: 22
3: 156
4: 1386
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185507_946185516 4 Left 946185507 2:217978578-217978600 CCCCCGGGCCTTCGCCTTCACCT 0: 1
1: 0
2: 2
3: 11
4: 179
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185500_946185516 16 Left 946185500 2:217978566-217978588 CCCCTGCCCCCGCCCCCGGGCCT 0: 1
1: 0
2: 22
3: 238
4: 1961
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type