ID: 946185516

View in Genome Browser
Species Human (GRCh38)
Location 2:217978605-217978627
Sequence CTGCGCCCGCTCCCAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 601
Summary {0: 1, 1: 0, 2: 7, 3: 54, 4: 539}

Found 18 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185512_946185516 -10 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185508_946185516 3 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185505_946185516 8 Left 946185505 2:217978574-217978596 CCCGCCCCCGGGCCTTCGCCTTC 0: 1
1: 0
2: 3
3: 39
4: 358
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185507_946185516 4 Left 946185507 2:217978578-217978600 CCCCCGGGCCTTCGCCTTCACCT 0: 1
1: 0
2: 2
3: 11
4: 179
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185493_946185516 26 Left 946185493 2:217978556-217978578 CCCCAGCCCGCCCCTGCCCCCGC 0: 1
1: 0
2: 33
3: 301
4: 2160
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185511_946185516 -4 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185506_946185516 7 Left 946185506 2:217978575-217978597 CCGCCCCCGGGCCTTCGCCTTCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185500_946185516 16 Left 946185500 2:217978566-217978588 CCCCTGCCCCCGCCCCCGGGCCT 0: 1
1: 0
2: 22
3: 238
4: 1961
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185495_946185516 24 Left 946185495 2:217978558-217978580 CCAGCCCGCCCCTGCCCCCGCCC 0: 2
1: 11
2: 106
3: 606
4: 3782
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185501_946185516 15 Left 946185501 2:217978567-217978589 CCCTGCCCCCGCCCCCGGGCCTT 0: 1
1: 0
2: 4
3: 95
4: 797
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185502_946185516 14 Left 946185502 2:217978568-217978590 CCTGCCCCCGCCCCCGGGCCTTC 0: 1
1: 0
2: 22
3: 156
4: 1386
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185504_946185516 9 Left 946185504 2:217978573-217978595 CCCCGCCCCCGGGCCTTCGCCTT 0: 1
1: 0
2: 0
3: 19
4: 231
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185503_946185516 10 Left 946185503 2:217978572-217978594 CCCCCGCCCCCGGGCCTTCGCCT 0: 1
1: 0
2: 1
3: 44
4: 503
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185509_946185516 2 Left 946185509 2:217978580-217978602 CCCGGGCCTTCGCCTTCACCTTG 0: 1
1: 0
2: 2
3: 31
4: 240
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185510_946185516 1 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185494_946185516 25 Left 946185494 2:217978557-217978579 CCCAGCCCGCCCCTGCCCCCGCC 0: 1
1: 2
2: 36
3: 418
4: 2287
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185498_946185516 19 Left 946185498 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG 0: 1
1: 10
2: 63
3: 572
4: 2915
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539
946185496_946185516 20 Left 946185496 2:217978562-217978584 CCCGCCCCTGCCCCCGCCCCCGG 0: 1
1: 16
2: 214
3: 933
4: 4447
Right 946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG 0: 1
1: 0
2: 7
3: 54
4: 539

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185516 Original CRISPR CTGCGCCCGCTCCCAGGCCC AGG Intronic
900102121 1:966410-966432 CTCCACCCTCGCCCAGGCCCTGG + Intergenic
900117037 1:1033326-1033348 CTGCGCCCGCGGCCCCGCCCTGG - Intronic
900158832 1:1213924-1213946 CTGCCCCAGCCCCCAGTCCCTGG + Intronic
900185464 1:1331258-1331280 CTCTGCCCGCTCCCCGCCCCGGG + Intergenic
900192660 1:1358078-1358100 CAGCCCCCGCTCCCAGGCCTGGG - Intronic
900245019 1:1632662-1632684 CCACGCCCGCTCCCAGCCCTGGG + Intronic
900256250 1:1699821-1699843 CCACGCCCGCTCCCAGCCCTGGG + Intronic
901049559 1:6419554-6419576 CTGCCCCCGCTCCGCGCCCCAGG + Intronic
901459216 1:9381764-9381786 CTGCGCCCGGCCCAAAGCCCAGG - Intergenic
901797381 1:11688157-11688179 CTGCCCCCTCTCCCAGGCCCAGG + Intronic
901883894 1:12209480-12209502 CTGGGCCTGCTCTCAGGACCGGG + Intergenic
902045880 1:13523992-13524014 ATGCTGCCCCTCCCAGGCCCGGG - Intergenic
902453481 1:16514419-16514441 CTGAACCCGCTCCCAGGGCACGG + Intergenic
902473533 1:16667082-16667104 CTGAACCCGCTCCCAGGGCACGG + Intergenic
902485270 1:16740360-16740382 CTGAACCCGCTCCCAGGGCACGG - Intronic
902499000 1:16895824-16895846 CTGAACCCGCTCCCAGGGCAGGG - Intronic
902587089 1:17446420-17446442 GTGCACCAGCTGCCAGGCCCGGG - Intergenic
902606977 1:17574151-17574173 CTCAGCCTGGTCCCAGGCCCAGG - Intronic
902688562 1:18095258-18095280 CTGTCCCAGCCCCCAGGCCCTGG - Intergenic
902698927 1:18158490-18158512 CTGCCCACCCACCCAGGCCCGGG + Intronic
902717644 1:18283458-18283480 CTGGCCCAGCTCCCAGGCCTAGG + Intronic
902743378 1:18456190-18456212 CTGTTCCCACTCCCAGCCCCAGG + Intergenic
902783167 1:18717200-18717222 CTGCTCGGGATCCCAGGCCCGGG - Intronic
902817879 1:18926414-18926436 CTGCCTCCCCTCCCTGGCCCAGG - Intronic
903140501 1:21336005-21336027 CTGCCCCTGCCCCCAGGGCCTGG - Intronic
903626694 1:24735803-24735825 CTGGGCACGCTTCCAGGCCCAGG - Intergenic
903667919 1:25019114-25019136 GTGCGCCAGCTCCTGGGCCCTGG - Intergenic
903668236 1:25021029-25021051 CTTCCCACGCTACCAGGCCCGGG + Intergenic
903883792 1:26529856-26529878 CTGCGCCGCCTCCCGGGTCCTGG - Intronic
904418755 1:30378185-30378207 CCAGGCCCCCTCCCAGGCCCTGG - Intergenic
904762635 1:32817072-32817094 CTGCGCCAGCGCCGAGTCCCCGG + Intronic
905187007 1:36203959-36203981 CTGGCTCCGCTCCCAGGCCGAGG + Intergenic
905442696 1:38005295-38005317 CCGCCCCCGCGCCCAGGCCGGGG - Intronic
905453844 1:38074193-38074215 CTGCGGCCCCTCCCAGGAGCTGG - Intergenic
905569305 1:38991346-38991368 CCGCGTCCGCTCCCGGTCCCTGG + Exonic
905734205 1:40314992-40315014 CTGGGCCCCCGGCCAGGCCCTGG - Intronic
905800359 1:40838835-40838857 CAGCGCCCGCTCCCACTCCCGGG - Exonic
905865161 1:41372491-41372513 CTGCAGCTGCTCCCAGGGCCTGG + Intronic
905898909 1:41567694-41567716 GTGGGCCAGCTCCCAGGCCAGGG - Intronic
905971089 1:42142989-42143011 CTGCACCCACTCCCATGCCTTGG + Intergenic
906146907 1:43565763-43565785 CTGCGCCCCTTCCCAGGCCCCGG - Intronic
906238958 1:44229727-44229749 CCGCTCCCGCTTCCAGGCCTTGG - Intronic
906262966 1:44407153-44407175 CTGCGCCGGCCCACTGGCCCGGG + Intronic
906318012 1:44800516-44800538 CCGCGCCCGCTCCCCCGGCCGGG + Exonic
907241583 1:53084108-53084130 CTTCCCCAGCTCCCAGGGCCCGG + Intronic
907898683 1:58717616-58717638 GTGCTCCCTCCCCCAGGCCCAGG - Intergenic
909461218 1:75916673-75916695 CTCCACCCTCTGCCAGGCCCTGG - Intergenic
910668926 1:89753556-89753578 AAGCGCCCGCCACCAGGCCCAGG + Intronic
911488091 1:98527433-98527455 CTTAGGCCGCTCCCAGGCTCTGG + Intergenic
912453722 1:109783845-109783867 CTGTGCCCACTCCCAGGCTTGGG - Intergenic
912928026 1:113930068-113930090 CGGCGCCCGGTCCCAGGCAGGGG - Intronic
913209360 1:116570496-116570518 CCGCGCCCGCTCCCCGTCCCGGG + Intronic
914517788 1:148388773-148388795 CTGAGCCCGCTCCCAAGGCTCGG + Intergenic
914900707 1:151709690-151709712 CTCCTCCCACCCCCAGGCCCAGG - Intronic
917944460 1:179954857-179954879 CTGGCCCCGCTCCCCGGCCCGGG - Exonic
917962263 1:180154714-180154736 CCCCGCCCGCTCCCGCGCCCAGG + Intergenic
918355411 1:183703138-183703160 CCCCGCCGGCTTCCAGGCCCTGG + Intronic
920029892 1:203030476-203030498 CTGCACCATCTCCCAAGCCCAGG - Intronic
920095373 1:203483266-203483288 CTGCGCCCGGGCCCAGTCCCGGG - Exonic
920340525 1:205272634-205272656 CTGAGCCTGCTCTCTGGCCCTGG - Exonic
921190039 1:212700314-212700336 CTGCGTCCGCCCCCCGGCGCGGG + Intergenic
921312811 1:213861381-213861403 CTGGGTGCGCACCCAGGCCCAGG + Intergenic
922581782 1:226703557-226703579 CGGCGCCCCCTCCCCGGCCGCGG - Intronic
922739433 1:228007044-228007066 CCGCGCCAGCTCCCAGGGCCCGG + Exonic
923023985 1:230189811-230189833 TTCCTCCCTCTCCCAGGCCCTGG + Intronic
924289756 1:242524819-242524841 CTCCCGCCGCGCCCAGGCCCGGG + Intergenic
924382588 1:243478088-243478110 CTTCTCCCGCCCCCAGGCCTCGG + Intronic
924527424 1:244864381-244864403 CTGCGGCTGCTCCTCGGCCCGGG + Exonic
924952369 1:248896844-248896866 GATCGCCCGCTCCCAGGCCAGGG + Intergenic
1062932503 10:1362630-1362652 CTCCGGCTGCTCCCAGGCACAGG + Intronic
1064086523 10:12349743-12349765 CTGCGCCCGCGCCGCGCCCCCGG + Exonic
1064443189 10:15371321-15371343 CGCTGCCCGCGCCCAGGCCCCGG + Intergenic
1064637804 10:17386959-17386981 CTCCGCCAGCTTCTAGGCCCTGG + Intronic
1065661133 10:28005167-28005189 CTGCCCCCTCTCCTAGTCCCTGG - Intergenic
1066370288 10:34814469-34814491 CTTTCCCGGCTCCCAGGCCCCGG - Intronic
1066492427 10:35906683-35906705 CTTCACTCGCTCACAGGCCCAGG - Intergenic
1067017640 10:42770017-42770039 CTGTACCCATTCCCAGGCCCAGG + Intergenic
1069483714 10:68807140-68807162 AGGCGCCCGCCACCAGGCCCGGG + Intergenic
1069680776 10:70283836-70283858 GGGCGTGCGCTCCCAGGCCCCGG + Intergenic
1070751884 10:78968698-78968720 CCTGGCCAGCTCCCAGGCCCTGG - Intergenic
1071464207 10:85924873-85924895 AAGCGCCCGCTCACAGCCCCGGG + Intronic
1071597835 10:86940934-86940956 CAAAGCCAGCTCCCAGGCCCAGG + Intronic
1072656466 10:97333917-97333939 CTGCGGCCTCCCCCGGGCCCAGG + Exonic
1073097302 10:100987618-100987640 CCGCGCCGGCCCCCAGCCCCAGG - Intronic
1073111451 10:101065289-101065311 CTGCCCTTCCTCCCAGGCCCTGG + Exonic
1073180392 10:101579733-101579755 GTGTGCCGGCTCCCAGGGCCAGG - Exonic
1073208564 10:101781221-101781243 CTCCACCCTCCCCCAGGCCCAGG + Intergenic
1073217302 10:101843592-101843614 CGGCGCCCCCTCCCACGGCCCGG - Intronic
1076244330 10:128934235-128934257 CTGAGGCTGCTCCCCGGCCCAGG - Intergenic
1076583625 10:131531396-131531418 CTGCACCTGCCCCCAGTCCCTGG - Intergenic
1076839386 10:133038604-133038626 CAGCCCCAGCTCCCAGGCCCGGG + Intergenic
1076852560 10:133100171-133100193 CTGGGCCCAGGCCCAGGCCCAGG - Intronic
1077103033 11:830530-830552 CCGGGCCCACTCCCAGCCCCTGG + Intronic
1077143915 11:1036438-1036460 CAGCCCCCGCTGCCAGGCCCGGG - Intronic
1077151116 11:1073569-1073591 CTGCGCTCCCTGCCAGGACCTGG - Intergenic
1077276603 11:1714125-1714147 CTTTCCCCACTCCCAGGCCCTGG - Intergenic
1077360403 11:2138132-2138154 CTCCGCCCGCTCCCGGCCCGGGG - Intronic
1077529222 11:3087467-3087489 CTGGCCCCGCACCCAGGCCGGGG - Exonic
1078086612 11:8237224-8237246 CTGGGCCCACACCCAGGCCCGGG + Intronic
1079340409 11:19607013-19607035 ATGGGCCAGCTCCCAGGCCAGGG + Intronic
1080230308 11:30012583-30012605 CCTCTCCCGCTCCCGGGCCCGGG + Exonic
1081691274 11:45080239-45080261 CAGCGCCAGCTCCAGGGCCCAGG + Intergenic
1081868217 11:46371392-46371414 GTGCCCCCGCCCCCAGGGCCAGG + Intronic
1082003778 11:47408752-47408774 CTGGGCCGGCTCCCAGGACCCGG + Intronic
1082028854 11:47590740-47590762 CTGGGCCCGACCCCCGGCCCGGG - Exonic
1082880177 11:58029393-58029415 CTGTGCCAGGTTCCAGGCCCGGG - Intronic
1083088376 11:60174406-60174428 CTCCGCCACCTCCCAGGCTCAGG + Intronic
1083331380 11:61899998-61900020 CAGGGCCCCTTCCCAGGCCCGGG + Intronic
1083335137 11:61917637-61917659 CGGCGCGCGCTCCCAAGGCCTGG + Intronic
1083473949 11:62903653-62903675 CTGGGCCAGCTCCAAGGTCCTGG - Intergenic
1083618484 11:64037524-64037546 CAGCGTCCCCTCCCAGGCACGGG - Intronic
1083627316 11:64078329-64078351 CTGCCTCCCCTCCCAGTCCCTGG + Intronic
1083628504 11:64084198-64084220 CTCAGCCCCCTCCCAGGCCTGGG + Intronic
1083670985 11:64299852-64299874 CTCCGCCTCCTCCCTGGCCCCGG + Exonic
1083673645 11:64313894-64313916 CTGGGTCCCCTCCCAGCCCCGGG + Intronic
1083745380 11:64733311-64733333 CAGCACCGGCTCCCAGGACCAGG - Intronic
1083747621 11:64744600-64744622 CTGCCCCCTCTCCCAGACCCGGG + Intronic
1084041543 11:66545833-66545855 CAGCGCCAGCTGCAAGGCCCGGG + Exonic
1084072489 11:66745246-66745268 CCGCGCCCCCTCCCAGCACCCGG - Intronic
1084170035 11:67396668-67396690 CTGAGCCTCCTCCCAGGCCAAGG + Intronic
1084190924 11:67498387-67498409 CTGGGCCTGCTGGCAGGCCCTGG + Intronic
1084204536 11:67584046-67584068 CTGCCCCCCCTCCCCGCCCCCGG - Intronic
1084270750 11:68027936-68027958 CTGAGCCCTTCCCCAGGCCCAGG + Exonic
1084336443 11:68460653-68460675 CTGCCCCCGCCCCCAGCTCCAGG - Intergenic
1084391913 11:68882925-68882947 GAGCCCCCGCTCCCAGCCCCAGG + Intergenic
1084564001 11:69919390-69919412 CTGGGCCGGCTCCCACCCCCCGG + Intergenic
1084736209 11:71107295-71107317 CTGGGCCCTGTCCCAGACCCTGG + Intronic
1085519529 11:77129973-77129995 CCGGGCCCGGGCCCAGGCCCAGG + Intronic
1086374964 11:86190773-86190795 CTGAGCCTGCTCCCAGACCCAGG - Intergenic
1086590527 11:88509335-88509357 CAGCGCCAGCGCCCAGGCCACGG + Exonic
1087169585 11:95037553-95037575 CCGCGCCAGTTTCCAGGCCCGGG + Intergenic
1088047489 11:105471670-105471692 CTCCACCCGCTGACAGGCCCTGG - Intergenic
1089351201 11:117822601-117822623 CAGCGGCCTCTCCCAGCCCCAGG - Intronic
1091289441 11:134429307-134429329 GTGGCTCCGCTCCCAGGCCCAGG + Intergenic
1091297795 11:134486143-134486165 CTCCGCCCCATGCCAGGCCCTGG - Intergenic
1091400850 12:179734-179756 CTTGGCTCTCTCCCAGGCCCGGG - Intergenic
1091747122 12:2999599-2999621 CTGGGCCGGCTCCCGAGCCCGGG + Intronic
1091849728 12:3685715-3685737 TTTCGCCCACTCCCAGCCCCTGG - Intronic
1092166649 12:6346744-6346766 CTGTACCCTCTCCCAGCCCCAGG + Intergenic
1095409984 12:41911124-41911146 CTGGGCCTGTTCCAAGGCCCTGG - Intergenic
1096075270 12:48800201-48800223 CTCCGTCCTCTCCCAGACCCTGG + Intergenic
1096105425 12:48994814-48994836 CTGCCCCGGCCCCCAGCCCCCGG - Intergenic
1096241121 12:49961093-49961115 AGGCGCCCTCTCCCAGGCCGGGG - Intergenic
1097196050 12:57243020-57243042 CCCCACCCCCTCCCAGGCCCAGG + Intergenic
1097264751 12:57738524-57738546 CAGCGCCCCCACCCAGGCCGGGG - Intronic
1097289119 12:57899109-57899131 GTGCTCCCACTCCCAGCCCCAGG + Intergenic
1098106008 12:67069418-67069440 CTGCACCAGCTCCCCGCCCCCGG - Intergenic
1101741024 12:107500249-107500271 CTGCGCCCGCTCCCCAGGACTGG + Intronic
1102221248 12:111196017-111196039 CTGATCCCACTCCCAGCCCCAGG + Intronic
1102266680 12:111491904-111491926 AAGCTCCCGATCCCAGGCCCTGG + Intronic
1103901057 12:124303806-124303828 CAGCGCCCTCCCACAGGCCCGGG - Intronic
1105859420 13:24395606-24395628 CTGCCCCCTGCCCCAGGCCCAGG + Intergenic
1106250831 13:27980457-27980479 CTCCGCGCTCACCCAGGCCCAGG + Intronic
1106413041 13:29524360-29524382 CTGTTACCGCTGCCAGGCCCTGG + Intronic
1106559789 13:30838325-30838347 CTGCCCATGCTCCCAGCCCCAGG - Intergenic
1106776650 13:33016268-33016290 CTGCCCCCGCCCCCAGTGCCAGG + Intergenic
1108080546 13:46730440-46730462 CTCCGCCCTCTCCCATCCCCAGG + Intronic
1108156421 13:47589918-47589940 CTGCCCCCACCCCCAGTCCCAGG - Intergenic
1108932428 13:55843241-55843263 CTGTGCCAGTTTCCAGGCCCTGG + Intergenic
1110318277 13:74134549-74134571 CTGCCCCCGCCCTCCGGCCCCGG + Intergenic
1112325272 13:98439574-98439596 CAGCGCCCGCTCCCTGGAGCTGG + Intronic
1112344298 13:98577167-98577189 CCGCGCCCGCCCCCACGGCCCGG + Intronic
1112686164 13:101830267-101830289 CTGCCTCCTCTCCCAGGCCCAGG - Intronic
1113085633 13:106567443-106567465 CCGCGCCCGGTCCCCAGCCCCGG + Intronic
1113732472 13:112651314-112651336 CTCTGCCCACTCCGAGGCCCTGG + Intronic
1113970478 13:114185138-114185160 CAGGACCTGCTCCCAGGCCCAGG + Intergenic
1113979730 13:114264442-114264464 CTGCGCCCGGTCCCAGGCTGAGG + Intronic
1114363481 14:22002161-22002183 ATGCACCTGCTACCAGGCCCTGG + Intergenic
1114473778 14:22980864-22980886 CCGCGCCCCCACCCGGGCCCAGG - Intronic
1116957875 14:50943383-50943405 CTGCTCCCGCCCCCACGCCGTGG + Intronic
1117141020 14:52791394-52791416 CTGCTCTCGCGCCCCGGCCCCGG + Intronic
1117383744 14:55191368-55191390 TTGCTCCCGCTCGCAGCCCCCGG + Intronic
1118046204 14:61974179-61974201 CTGCCCCCGCTCCCACCACCAGG - Intergenic
1118137491 14:63045555-63045577 CAGAGCCCGCGCCCAGGCGCCGG - Intronic
1121754572 14:96392073-96392095 CTGCCCCGCCTCCCTGGCCCGGG + Intergenic
1121884120 14:97527289-97527311 CTGAGCCTGCTCCCAGGGCCTGG + Intergenic
1122425623 14:101603590-101603612 CCGCTTCCCCTCCCAGGCCCCGG - Intergenic
1122556854 14:102585238-102585260 CAGCCCCCTGTCCCAGGCCCTGG - Intergenic
1122703275 14:103604652-103604674 CAGCTCCCACTCCCAGTCCCTGG + Intronic
1122847243 14:104506623-104506645 CTGCCCCCTGCCCCAGGCCCAGG + Intronic
1124235223 15:27984281-27984303 CCGGGCCCACTCCCAGGCACTGG - Intronic
1124392275 15:29269786-29269808 CTGCGCGCGCCTCCAGGCACCGG - Exonic
1125565958 15:40678526-40678548 CGGCGCCCGCCACCACGCCCGGG + Intergenic
1127389057 15:58490714-58490736 CTCCACCCACTCCCAGCCCCGGG - Intronic
1127753512 15:62068261-62068283 CCGCGCGGGCTCCCAGTCCCCGG + Exonic
1128650602 15:69409958-69409980 CTGCCCCTACTCCCAGGCCTTGG - Intergenic
1128743177 15:70097021-70097043 CCGCGCCCGCCGCCCGGCCCCGG - Exonic
1128758835 15:70201097-70201119 CCGCCCCCTCGCCCAGGCCCAGG - Intergenic
1128807229 15:70540082-70540104 CAGGTCTCGCTCCCAGGCCCTGG + Intergenic
1129334356 15:74843387-74843409 CTGCGCCCGCTAGGAGTCCCCGG - Intergenic
1129710577 15:77818707-77818729 CGGGGACAGCTCCCAGGCCCAGG - Intronic
1130899079 15:88193381-88193403 CAGAGCTCCCTCCCAGGCCCAGG + Intronic
1131838119 15:96410042-96410064 CTGCGCTCCCTCCCAGCCTCCGG + Intergenic
1132232447 15:100193955-100193977 TTGGGCCGGCTCCCAGGGCCAGG + Intronic
1132464739 16:72356-72378 CCGCGACCCCTCCCCGGCCCCGG + Intronic
1132539046 16:499397-499419 CTGCGCCCCATCCTAGGCACGGG - Intronic
1132557568 16:579290-579312 CTGAGGCCGCGCACAGGCCCTGG + Intronic
1132567722 16:630957-630979 GTGCGGGGGCTCCCAGGCCCTGG - Exonic
1132665088 16:1077912-1077934 TTGAGCCCCCTCCCAGGCCCTGG - Intergenic
1132828987 16:1918434-1918456 CCGCGCCCGCTCCCAGGCTGCGG - Exonic
1132831347 16:1929883-1929905 CTGCGCACGGTCCCGCGCCCGGG + Intergenic
1132947988 16:2543206-2543228 CTGTCCCCGCTCCCAACCCCGGG - Intronic
1132966459 16:2658136-2658158 CTGTCCCCGCTCCCAACCCCGGG + Intergenic
1133286148 16:4691833-4691855 CAGCCCCCGCTCCCCTGCCCAGG + Intergenic
1133326418 16:4944930-4944952 CTGCTCCAGCTGCCAGGGCCTGG - Intronic
1134279273 16:12803572-12803594 CTATGGCGGCTCCCAGGCCCCGG + Intronic
1134490324 16:14691352-14691374 CTGTGGCAGCTCCCGGGCCCTGG + Intronic
1134495705 16:14730469-14730491 CTGTGGCAGCTCCCGGGCCCTGG + Intronic
1134501252 16:14770780-14770802 CTGTGGCAGCTCCCAGGCCCTGG + Intronic
1134579328 16:15358254-15358276 CTGTGGCAGCTCCCAGGCCCTGG - Intergenic
1134723254 16:16399300-16399322 CTGTGGCAGCTCCCAGGCCCTGG + Intergenic
1134944174 16:18312570-18312592 CTGTGGCAGCTCCCAGGCCCTGG - Intergenic
1135281698 16:21158612-21158634 CTGCCTCCGCCCCCTGGCCCGGG - Exonic
1135407013 16:22206140-22206162 CGGCGCTGGCTCCCAGCCCCAGG - Intergenic
1136115344 16:28091049-28091071 CTCAGCCCGCAGCCAGGCCCAGG + Intergenic
1136116558 16:28098307-28098329 CTCCGCCTGCTCCAACGCCCTGG + Exonic
1136165598 16:28450912-28450934 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1136197374 16:28664097-28664119 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136213713 16:28778244-28778266 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136251685 16:29009532-29009554 CTGCGCCCTCCTCCTGGCCCTGG + Intergenic
1136258447 16:29058168-29058190 CTGTGGCAGCTCCCGGGCCCTGG + Intergenic
1136320048 16:29478148-29478170 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1136428381 16:30183843-30183865 CTGCGCCCGCTACCTGGCCCCGG - Intronic
1136434619 16:30217489-30217511 CTGTGGCAGCTCCCGGGCCCTGG - Intergenic
1136555214 16:31003538-31003560 ATGCGGCCTCTCCCTGGCCCGGG + Intronic
1136573151 16:31108697-31108719 CTGGCCGCGCTCCCAGGGCCCGG + Intronic
1137543153 16:49378315-49378337 CTCCGACCTCTCCCAGGGCCCGG + Intronic
1138178787 16:54929046-54929068 CTGCGCGCTCCCCCAGGCTCGGG + Intergenic
1139392203 16:66612091-66612113 CTGCACCCGCACCCACACCCTGG + Intronic
1139916855 16:70433693-70433715 CTGCACCCACTCCAAGACCCTGG + Intronic
1140078516 16:71723558-71723580 CCGCGCCCGCGTCCAGGCCTCGG - Intronic
1141020724 16:80493645-80493667 CTGTGCCAGTTTCCAGGCCCAGG - Intergenic
1142016452 16:87750759-87750781 CTGCGCCCGCTGTCTGGCCCAGG - Intronic
1142131416 16:88433180-88433202 CAGCTCCAGCTCCCAGGGCCTGG + Exonic
1142175576 16:88643512-88643534 CTGCGGCCGCTCCCGGGGCTTGG + Exonic
1142196720 16:88742453-88742475 CTGCGGCCCCTCCCCGTCCCCGG - Intronic
1142252865 16:89000723-89000745 CTGGGGCCTCTCCCATGCCCGGG + Intergenic
1142596419 17:1031970-1031992 GAGCGCCGCCTCCCAGGCCCAGG + Intronic
1142695014 17:1628743-1628765 CTGCCCCCGCGCCCTCGCCCCGG + Intronic
1142750862 17:1986823-1986845 CTGCCCCCCGACCCAGGCCCAGG + Intronic
1142997710 17:3770762-3770784 CTGGGCCCTCCCCCAGCCCCTGG + Intronic
1143140322 17:4738941-4738963 CGGCACCCATTCCCAGGCCCAGG + Intronic
1143518075 17:7429924-7429946 GGGCACCCACTCCCAGGCCCAGG + Intergenic
1143783243 17:9240270-9240292 CGGCGGCCGCGCCCAGGCCCAGG - Exonic
1144648582 17:16991621-16991643 CAGCAGCCGCTCCCAGGCTCAGG + Intergenic
1144756026 17:17681329-17681351 CTGCGCTCGCTCGCGGCCCCGGG - Intergenic
1144786253 17:17833502-17833524 CTGTTCCTGCTCCCAGCCCCGGG - Intronic
1145978501 17:28997957-28997979 CTGCCCCCACCCCCAGGCTCTGG + Intronic
1146401581 17:32504202-32504224 CTGACCTGGCTCCCAGGCCCGGG + Intronic
1147139391 17:38452844-38452866 CTGCCCCCTCTCCCACCCCCTGG - Intronic
1147440347 17:40443707-40443729 CCGCGCCCGCGCCCAGTCCTCGG + Exonic
1147495276 17:40909499-40909521 CAGCACCCTCTCCCAGGCTCCGG + Intergenic
1148072247 17:44915271-44915293 CTCTGCCCGCTCACTGGCCCGGG + Exonic
1148151049 17:45396618-45396640 CTGCGCCCCGTCCCGGTCCCGGG + Intronic
1148561276 17:48608045-48608067 CTACACCCGCTACCAGACCCTGG - Exonic
1148736714 17:49869271-49869293 CTGCCCCCTCCTCCAGGCCCAGG - Intergenic
1148766981 17:50045267-50045289 CTGGCCCCACTCCCAGGCCATGG + Intergenic
1148855088 17:50574591-50574613 CTTCCCCCTCTCCCAAGCCCAGG - Intronic
1148912448 17:50950140-50950162 CTGCCCCAGGTCGCAGGCCCTGG + Intergenic
1149524901 17:57347892-57347914 CTGTGCCCTTTGCCAGGCCCTGG + Intronic
1149558822 17:57593779-57593801 CTGCCCCAGCCCCCACGCCCAGG - Intronic
1149772408 17:59331988-59332010 CGGCGGCCGCTCCCCGTCCCCGG - Intronic
1150002764 17:61451985-61452007 CGGCGCCCGCTTCCAGGCAGCGG - Intergenic
1150895651 17:69207740-69207762 CTCCACCCACTGCCAGGCCCTGG - Intronic
1151428459 17:74046785-74046807 CTCCTCCCACTCCCAGCCCCTGG + Intergenic
1151668219 17:75557669-75557691 CTGAGCCCGCAGCAAGGCCCTGG - Intronic
1151728983 17:75899922-75899944 ATGCAGCCGCTTCCAGGCCCCGG + Intronic
1151801993 17:76384324-76384346 CTGCGCTCGCGGCCGGGCCCGGG + Intronic
1152175165 17:78782362-78782384 CTGCGCCCGCCCCCTGCCCCCGG + Intergenic
1152356725 17:79811150-79811172 CTTCGCCCGCTCCCATCCCGCGG - Intergenic
1152554572 17:81046504-81046526 GTGAGCCAGCTCCCAGGCTCTGG + Intronic
1152643698 17:81459405-81459427 CCGCAGCCACTCCCAGGCCCAGG + Intronic
1152677248 17:81648012-81648034 CTGCGTCCGCATCCAGGCGCAGG - Exonic
1152730862 17:81969256-81969278 CTGAGCCCTGTCCCAGGCACGGG + Intergenic
1152737274 17:82003754-82003776 CAGAGCCCGCGCCCACGCCCTGG + Intronic
1152748977 17:82053852-82053874 CTGTGCCTGCTCCCAGGATCTGG + Exonic
1152820451 17:82435228-82435250 CCGCACCTGCCCCCAGGCCCCGG + Intronic
1152992194 18:373699-373721 CTGCTGCTTCTCCCAGGCCCTGG - Intronic
1153838047 18:8981904-8981926 CTGGTCCCCCTCCCAGGCCTAGG - Intergenic
1154304253 18:13218633-13218655 CACCGCGCGCTCCCCGGCCCCGG + Intronic
1154485964 18:14871413-14871435 CTGTGCCAGCTGCCAGCCCCTGG + Intergenic
1157848918 18:51030019-51030041 CTCCGCCCGCGCTGAGGCCCAGG + Intronic
1159586759 18:70289308-70289330 CGGCCCCCGTTCCCCGGCCCTGG - Intronic
1159670095 18:71212387-71212409 CTGCGCCCGCACTCAGCCCTTGG + Intergenic
1159773970 18:72583073-72583095 CTGGGCCCGGGCCCAGGCCCAGG + Intronic
1159798083 18:72867713-72867735 CTGCGCCCTCTCCCCGGCCCCGG - Exonic
1160530116 18:79557604-79557626 CTGGGGCTGCTCCCAGGCCGAGG + Intergenic
1160540097 18:79616699-79616721 CTGCGCCCACTCCGAGCTCCCGG + Intergenic
1160894231 19:1395227-1395249 CTGCGCCGGCTCCCAGTCCCTGG + Intronic
1160902036 19:1433549-1433571 CTGCCCCCACGCCCAGGCCTTGG + Intronic
1161040577 19:2108930-2108952 CCGCACCAGCTCCCAGGCCTCGG + Intronic
1161245581 19:3249832-3249854 CTGCTCCCTATCCCAGGGCCAGG + Intronic
1161265074 19:3360082-3360104 GTGCGCCCCCTCCCTGGCCCGGG - Intronic
1161299640 19:3536597-3536619 CTGCGGCGGTTCCCAGTCCCAGG - Intronic
1161526555 19:4759720-4759742 CAGCTCCCGCTCCCAGTCTCCGG - Intergenic
1161557948 19:4955087-4955109 CTGCACCCGCTCCCCAGCTCCGG + Intronic
1162720158 19:12657370-12657392 CTGTCCCCTTTCCCAGGCCCTGG + Intronic
1162741932 19:12778406-12778428 CTCCACCCGCTCCCAGGGGCTGG - Intronic
1162756716 19:12865238-12865260 CTGTGCCCCCCACCAGGCCCTGG - Intronic
1162778744 19:12995889-12995911 CCGCGCCCGCTCCCCTCCCCCGG - Intronic
1162860968 19:13505790-13505812 GTGCCCCCTCTCCCAGCCCCTGG + Intronic
1163012327 19:14433682-14433704 CGGCGCCCCCTCCCTGGGCCGGG + Intronic
1163023348 19:14495650-14495672 CTGCGTCCCCCCCAAGGCCCTGG + Intronic
1163118221 19:15200667-15200689 CTGCGCCCCTTCCCCGACCCTGG + Intronic
1163316199 19:16542255-16542277 CCCCGCCCCCTCCCAGACCCGGG + Intronic
1164146802 19:22517620-22517642 CTGCGCCCTCTCTCAAGCCTGGG + Intronic
1165349734 19:35269184-35269206 GTGCCCCCGCGCCCCGGCCCCGG + Intronic
1165751725 19:38264445-38264467 GCGCGGCCGCTCCCCGGCCCTGG - Exonic
1165793634 19:38506455-38506477 CTGCATCCACTCCCAGGCCATGG + Exonic
1166184074 19:41128068-41128090 CTGCGCCCGCGCTAACGCCCCGG + Exonic
1166731889 19:45064045-45064067 CCGCTCCCGCTCCCCGACCCCGG + Exonic
1166791667 19:45402537-45402559 CTGCGCCTGAGCTCAGGCCCGGG + Intronic
1167262880 19:48469026-48469048 CTGCGCCTGCTCAAAGGCCCTGG - Exonic
1167684879 19:50950027-50950049 CGGCCCCAGCTCCCAGGTCCTGG + Exonic
1167688268 19:50969607-50969629 CTGGGCCTGCTCCCCAGCCCGGG - Intronic
1167740290 19:51320486-51320508 CAGCCCCCACTCCCTGGCCCTGG + Intronic
1168154120 19:54463738-54463760 CTGCGCCCTCCCCCAGCGCCAGG + Intergenic
1168654708 19:58118520-58118542 CTGCGAGCGCTCCCAGGTTCTGG - Intergenic
1168701105 19:58440073-58440095 CTGCACCCACTCCCGTGCCCTGG + Exonic
1202705724 1_KI270713v1_random:22158-22180 CTGAACCCGCTCCCAGGGCACGG + Intergenic
925972830 2:9119090-9119112 CATCGCCCGCTCCCAGCACCTGG + Intergenic
926133944 2:10323459-10323481 GTGCGCCCACTGCCAGGGCCAGG - Intronic
926140784 2:10366710-10366732 CTGCCCCGGCTCCCCAGCCCCGG + Intronic
926250995 2:11155397-11155419 CTCCGCGCGCCGCCAGGCCCCGG - Exonic
927149757 2:20188847-20188869 CTCCGCCTTCTCCCAGGGCCAGG + Intergenic
928093832 2:28392380-28392402 CTGCGGCCTCTCCCCCGCCCTGG - Intergenic
928319022 2:30268572-30268594 ATCCCCCTGCTCCCAGGCCCAGG - Intronic
928511705 2:32009890-32009912 CTGCGCCCTCCCTCAGGACCAGG - Intronic
929581360 2:43083453-43083475 GTGTCCCCGCTCCCAGGGCCTGG + Intergenic
932307387 2:70713736-70713758 CTGCGCCCTCCACCAGGCCAGGG - Intronic
933692453 2:85189876-85189898 CTGGGCTCACTCCCGGGCCCTGG - Intronic
935758894 2:106300332-106300354 AGGCGCCCGCTGCCAGGCCCAGG - Intergenic
936279295 2:111123335-111123357 CTGCGCCCGCTCCTGTGCTCCGG + Intronic
936996760 2:118423938-118423960 CTGAGCCCGCACCCCTGCCCTGG - Intergenic
937287526 2:120762687-120762709 CAGCACCAGCCCCCAGGCCCTGG + Intronic
938074334 2:128323688-128323710 CTGTGCCCCCACCCAGGGCCCGG - Intergenic
938077359 2:128346853-128346875 CTCCAGCCGCTCCCCGGCCCGGG - Intergenic
938339134 2:130523801-130523823 CTCTGCCCTCTCCCAGGCCTGGG + Intronic
938350704 2:130596949-130596971 CTCTGCCCTCTCCCAGGCCCGGG - Intronic
938796134 2:134719220-134719242 GTGCGCCGGCTCCCGCGCCCGGG - Intergenic
939240780 2:139557140-139557162 AGGCGCCCGCTGCCATGCCCGGG + Intergenic
940597677 2:155815766-155815788 CTGCCCCAGCTCCAAGGCCTAGG - Intergenic
941295637 2:163736033-163736055 CTGCGCCTGCGCCCAGCCTCTGG - Intergenic
942083979 2:172427653-172427675 CTGCGCCCGGCCCCACCCCCGGG - Intronic
942189050 2:173453249-173453271 CTGCCCCAGCTCCCCAGCCCTGG - Intergenic
943755655 2:191554507-191554529 CTGAGCCAGCTCCAGGGCCCTGG - Intergenic
945355827 2:208838447-208838469 CTGTGCCCCTTCCCAAGCCCAGG + Intronic
946185516 2:217978605-217978627 CTGCGCCCGCTCCCAGGCCCAGG + Intronic
946248848 2:218401170-218401192 CTGCCCTGGGTCCCAGGCCCTGG + Intronic
946399123 2:219459632-219459654 CTGCTTCCGTTCCCAGTCCCTGG + Intronic
947389561 2:229625257-229625279 CTGCCACCCCTCCCAGCCCCCGG - Intronic
947536130 2:230941413-230941435 CTGCCCCCGCTCCCAGACCCAGG + Intronic
948264790 2:236628610-236628632 CTGTGGCCCCTACCAGGCCCTGG + Intergenic
1168965222 20:1894682-1894704 CCGCGCCGGCGCCCGGGCCCCGG - Intronic
1169208610 20:3753710-3753732 CTCCGTCCTCTCCCAGACCCTGG + Exonic
1169255128 20:4091387-4091409 CGGCTCCCCTTCCCAGGCCCAGG - Intergenic
1169262512 20:4148983-4149005 GTGCGCCCGCTCTCCGGCCCCGG + Intronic
1169497040 20:6124987-6125009 CTACCCCCGACCCCAGGCCCAGG + Intergenic
1171011366 20:21510947-21510969 CGGGCCCGGCTCCCAGGCCCAGG + Intergenic
1171210193 20:23310701-23310723 CTGTGCCCCTTCCCTGGCCCTGG + Intergenic
1172529413 20:35619512-35619534 CTGCTGCCGCTCCCCAGCCCGGG - Intronic
1174148340 20:48468215-48468237 CTGCACCTGCTCCCAGGCAAAGG + Intergenic
1174168728 20:48603464-48603486 CTGTTCCAGCTCCCAGGGCCAGG - Intergenic
1174380531 20:50153025-50153047 CTGTGCCCTAGCCCAGGCCCTGG - Intronic
1174494547 20:50930720-50930742 ATGCGCCCGCGCCCGGGGCCAGG + Intronic
1175108485 20:56630312-56630334 CTGCCCCTGCCCGCAGGCCCGGG + Intronic
1175404598 20:58718019-58718041 CTGGGTCCTCTCCCAGGCCGGGG - Intronic
1175515114 20:59564462-59564484 CAGCGTCCGCCCCCAGGCCAAGG + Intergenic
1175522316 20:59609655-59609677 CTCCGCCCTCTCCCACGCCCAGG - Intronic
1175723883 20:61303761-61303783 CTGTGCCCACCCCCAGGCCCGGG + Intronic
1175911422 20:62407072-62407094 CTCCGCCCGGGCCCAGGCTCGGG + Exonic
1175960155 20:62631760-62631782 CAGGACCCACTCCCAGGCCCAGG - Intergenic
1176207215 20:63895493-63895515 CCGCGCCCCCGCCCCGGCCCAGG - Intronic
1176221029 20:63969524-63969546 CCGCGCCCGCTCCCGGCCCCAGG - Intronic
1176299990 21:5094964-5094986 CTGCCCCCGGGCCCAGGGCCTGG + Intergenic
1176548057 21:8209887-8209909 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176555950 21:8254097-8254119 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176566988 21:8392922-8392944 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176574887 21:8437132-8437154 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176611502 21:8988428-8988450 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1176795340 21:13367965-13367987 CTGTGCCAGCTGCCAGCCCCTGG - Intergenic
1178913287 21:36693331-36693353 CTGAGCCGGCGCCCAGGGCCGGG + Intergenic
1179661549 21:42879181-42879203 CGGCGTCCGCTCCCCGGCTCCGG - Intronic
1179780160 21:43694477-43694499 CTTCTCCAGCTCTCAGGCCCAGG - Exonic
1179857032 21:44166947-44166969 CTGCCCCCGGGCCCAGGGCCTGG - Intergenic
1179882571 21:44299768-44299790 CTTCGCCAGCGCCGAGGCCCCGG - Intergenic
1180078145 21:45473553-45473575 CTGCCCGCCCTCCCAGGCCTTGG + Intronic
1180762269 22:18219842-18219864 CTGCGCCCCCTCCCCGCACCCGG + Intergenic
1180773398 22:18404766-18404788 CTGCGCCCCCTCCCCGCACCCGG - Intergenic
1180804749 22:18654315-18654337 CTGCGCCCCCTCCCCGCACCCGG - Intergenic
1180805995 22:18715095-18715117 CTGCGCCCCCTCCCCGCACCCGG + Intergenic
1180840869 22:18958266-18958288 CTGCGCCCACGCTCAGGGCCAGG - Intergenic
1180845073 22:18976374-18976396 CTGCCCTGCCTCCCAGGCCCGGG + Intergenic
1181060621 22:20280508-20280530 CTGCGCCCACGCTCAGGGCCAGG + Intronic
1181192494 22:21151699-21151721 CTGCGCCCCCTCCCCGCACCCGG - Intergenic
1181216945 22:21340876-21340898 CTGCGCCCCCTCCCCGCACCCGG + Intergenic
1181363599 22:22357352-22357374 CTGCCCCCGCTCCCAAGTCCCGG - Intergenic
1181366409 22:22380433-22380455 CTGCCCCCTCTCTCAGGTCCAGG - Intergenic
1181567914 22:23751004-23751026 CTGCGGCCCCGCCCCGGCCCAGG - Exonic
1181638521 22:24185253-24185275 CTGCACCCTGACCCAGGCCCGGG + Exonic
1181711678 22:24695398-24695420 CTGCTGCCCCTCCCAGGCCCAGG - Intergenic
1183265104 22:36819990-36820012 CTGAGTCCGCTCCCAACCCCAGG - Intergenic
1183407858 22:37639379-37639401 CTGCGCCCGCAACCCGCCCCAGG - Intronic
1183431783 22:37770292-37770314 CCGCGCCCGCCACCACGCCCGGG - Intronic
1183493416 22:38128522-38128544 CTGTCCCAGCTCCCAGGCCCTGG + Intronic
1183500343 22:38175089-38175111 CTGCCGCAGCTGCCAGGCCCAGG + Intronic
1183717147 22:39540184-39540206 CTGAGCCTTCTTCCAGGCCCTGG + Intergenic
1183931453 22:41238173-41238195 CTGCCCCCGCTGCAGGGCCCGGG - Exonic
1184497042 22:44848107-44848129 CTGCCTCCGCTCTGAGGCCCCGG - Intronic
1184783540 22:46660850-46660872 CTGCACCTGCTCACAGGCCTTGG + Intronic
1184992771 22:48181980-48182002 CTGGGGCCTCCCCCAGGCCCTGG + Intergenic
1185085273 22:48737529-48737551 CGGTGCCCTCTCCCAGCCCCAGG - Intronic
1185112303 22:48907008-48907030 CTGCGCCATCACCCAGGCCAGGG - Intergenic
1203235228 22_KI270731v1_random:145748-145770 CTGCGCCCCCTCCCCGCACCCGG - Intergenic
1203252936 22_KI270733v1_random:126187-126209 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203260991 22_KI270733v1_random:171268-171290 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
950178057 3:10889875-10889897 CTGCCCTCGCTCCCATGCCAGGG + Intronic
952418998 3:33114558-33114580 CCTCGCCCCGTCCCAGGCCCCGG + Intronic
954257183 3:49415023-49415045 CTGCTCCCTCACCCAGGCACTGG + Exonic
956188222 3:66582813-66582835 CTGTGCCAGCGCCCAGGCCGCGG + Intergenic
959414097 3:106062323-106062345 CAGCGAGCTCTCCCAGGCCCTGG - Intergenic
961081528 3:124032940-124032962 CCCCGCCCCCTCCCTGGCCCGGG + Intergenic
961406686 3:126684716-126684738 CTGTGCCCTCTGCCAGGGCCTGG + Intergenic
961522288 3:127473708-127473730 CCGGACCCTCTCCCAGGCCCGGG + Intergenic
961673232 3:128549622-128549644 CTGCCCCCACCCCCATGCCCTGG - Intergenic
961809698 3:129514750-129514772 TGGCGCCCGCTCACAGCCCCCGG + Intronic
965292660 3:166903894-166903916 CTCCACCCGCTAACAGGCCCTGG + Intergenic
965608734 3:170522622-170522644 CTCCTCCCACTCCCAGCCCCTGG - Intronic
966911481 3:184562467-184562489 CGGCGCCCGCTCCGGGGCCCAGG + Intronic
967088124 3:186112190-186112212 CTGAGCCAGCTCCTGGGCCCAGG + Intronic
967511920 3:190322415-190322437 CTGCGGTTGCTCCCAGGCTCGGG + Exonic
968673051 4:1862643-1862665 CCCCGCCCCGTCCCAGGCCCCGG - Intergenic
969459659 4:7322242-7322264 CTGCTCCCACTCTCAGGCCTGGG - Intronic
969531083 4:7730720-7730742 ATGCGCCCTCCCCCAGCCCCTGG - Intronic
969582296 4:8072402-8072424 CTGCCCCCGACCCCAGGCCAGGG + Intronic
969700623 4:8765780-8765802 CTGCACCCACCCCCAGGTCCCGG - Intergenic
969734361 4:8977183-8977205 CTCCCCCCGTTCCCCGGCCCCGG + Intergenic
970192544 4:13529717-13529739 CTGCGCCCCCTCCCACTCCTAGG - Intergenic
972417932 4:38861067-38861089 CTGCACCACCTCCCAGGCTCTGG - Intergenic
973611189 4:52637274-52637296 CTCCACCCTCTCCCAGGCCCAGG + Intronic
975118479 4:70704878-70704900 CTGCTCCCCCGCCCAGGCCCGGG + Intronic
975667462 4:76746958-76746980 AGGCGCCCGCCACCAGGCCCCGG + Intronic
978454730 4:108876049-108876071 CTCCACCCGCTGACAGGCCCCGG - Intronic
979468655 4:121070982-121071004 CCGCACCCTATCCCAGGCCCAGG - Intronic
980704252 4:136472666-136472688 CTGCGCCCGGCCCCAAGTCCAGG - Intergenic
981297222 4:143146334-143146356 CTCCACCCGCTGACAGGCCCTGG - Intergenic
984698226 4:182800140-182800162 CTGCTCGCGCGCCCAGGCCCGGG - Exonic
984966380 4:185143583-185143605 CTGCGCCAGGCCACAGGCCCGGG + Intronic
985272971 4:188211524-188211546 CTCCGCCAGTTCCCAGCCCCTGG + Intergenic
985665971 5:1181690-1181712 GTGCGGCCTCTCCCTGGCCCGGG - Intergenic
985749684 5:1667190-1667212 CTGCGCCCCAACCCAGGCCTGGG + Intergenic
985778307 5:1856896-1856918 ACGCCCCCGCTCCCAGGGCCGGG + Intergenic
986150878 5:5129601-5129623 CTGCCTCCCCACCCAGGCCCTGG - Intergenic
986602341 5:9485231-9485253 CTTCTCCCACCCCCAGGCCCTGG + Intronic
987099946 5:14582323-14582345 CCGGGCTCGCTCCCAGGCGCAGG - Intronic
988935089 5:36073889-36073911 CTGAGTCTGCTCCCAGGCCTTGG + Intergenic
990557649 5:56951905-56951927 CCGCGCCCGCTCCCGCCCCCCGG + Intronic
991584406 5:68187601-68187623 CCCCGCCCGCTCCCAAGCCCGGG - Intergenic
994367051 5:98928582-98928604 CCTCCCCCGCGCCCAGGCCCGGG + Exonic
994378629 5:99043603-99043625 CCGCACCCGCTGACAGGCCCTGG - Intergenic
997417691 5:133741543-133741565 TTGCCCCCGCTCCCATTCCCTGG - Intergenic
997521377 5:134526331-134526353 CCGCGCCCCCTCGCCGGCCCGGG - Intronic
999389898 5:151182385-151182407 CTGCCCCTGATCCCAGGCCCAGG - Exonic
999754609 5:154655063-154655085 CTGCCCCCACACCCAGACCCAGG + Intergenic
1001979673 5:176030388-176030410 CTGTGCCAGCTGCCAGCCCCTGG - Intronic
1001993539 5:176135627-176135649 CTGAGCCCACACCCAGGCCCTGG - Intergenic
1002046202 5:176543087-176543109 CAGCTCCCGCTGCCGGGCCCGGG + Intronic
1002071324 5:176680356-176680378 CTGGGCCGGCTCCCGGGCGCGGG + Intergenic
1002104658 5:176874184-176874206 CTGCCCCAGCTCCCACGCCAAGG + Intronic
1002237744 5:177813375-177813397 CTGTGCCAGCTGCCAGCCCCTGG + Intergenic
1002275911 5:178104409-178104431 CTGTGCCAGCTGCCAGCCCCTGG - Intergenic
1002771127 6:291946-291968 CGGAGCCCGCTCCCCGGCCGGGG - Intronic
1003122321 6:3328660-3328682 CAGTGCCCGCCCCCATGCCCTGG + Intronic
1003323183 6:5071042-5071064 AGGCGCCCGCTACCACGCCCAGG - Intergenic
1003650727 6:7957848-7957870 CTCCGCCCTCCCCCAGCCCCTGG - Intronic
1004216742 6:13711169-13711191 CGGGGCCCGCTGCAAGGCCCGGG + Exonic
1005996129 6:30932438-30932460 CTGGGCCCCCACCCATGCCCGGG + Intergenic
1006455781 6:34131004-34131026 CTGCCTCAGCTCCCAGGCCAGGG + Intronic
1007241913 6:40432441-40432463 CTTTGCCCGCTCCCAGGCTTCGG - Exonic
1007380648 6:41488279-41488301 CTGCAGCCTCTCCAAGGCCCTGG + Intergenic
1007383301 6:41504157-41504179 CTGCCCCCGCTGGGAGGCCCGGG - Intergenic
1007584202 6:42978866-42978888 CCGCGCCCGCACCCAGGCCCCGG + Exonic
1007759675 6:44126849-44126871 GTGCGCCCTCCCCCAGGCCAGGG - Intronic
1009857897 6:69288201-69288223 CTCCACCCGCTAACAGGCCCCGG + Intronic
1011417021 6:87132674-87132696 AGGTGCCCGCTACCAGGCCCAGG + Intergenic
1012465857 6:99515521-99515543 CTCCCCGCGCTCCCGGGCCCCGG - Intronic
1013226054 6:108119918-108119940 CTGCGCGCACGCCCTGGCCCTGG + Intronic
1013833833 6:114308715-114308737 CTGCCCCAGCACCCAGTCCCAGG + Intronic
1015769475 6:136754127-136754149 AGGCGCCCGCCACCAGGCCCAGG - Intronic
1016340922 6:143060817-143060839 CCGCGCCCGCGCCCGCGCCCGGG + Intronic
1016658119 6:146543895-146543917 CGGCGGCCGCCCCCAGGCCGGGG - Exonic
1016959156 6:149654931-149654953 CTCCACCCGCTGACAGGCCCCGG - Intergenic
1018628730 6:165804790-165804812 CTCCGCCCGCGGCCCGGCCCCGG - Intronic
1018669560 6:166167708-166167730 CTGCGACGGCTCCCGGGTCCCGG + Exonic
1018757550 6:166862950-166862972 CTGCCCCCGCCCCGAGGGCCGGG + Intronic
1019265189 7:111276-111298 CTCCTCCAGCTCCCAGCCCCAGG + Intergenic
1019562653 7:1666149-1666171 CGGGGCCCGCACCCCGGCCCAGG + Intergenic
1019576506 7:1740189-1740211 CTGCACCTGCTCCCAGGGCCTGG - Intronic
1019937569 7:4266513-4266535 CTGCCCCCTCTCCCAGTCCGAGG + Exonic
1020058114 7:5132574-5132596 CCCCGCCCTCTCCCAGGCGCAGG + Intergenic
1020125536 7:5530844-5530866 CGGCGCGCGCCCCCAGCCCCCGG - Intronic
1020761051 7:12269056-12269078 CAGGACCCGCTCACAGGCCCAGG + Intergenic
1022474206 7:30699700-30699722 CTGCCCCCTCACCCAGGCACGGG + Intronic
1023983100 7:45080921-45080943 CTGAGTCAGCACCCAGGCCCCGG - Exonic
1025806458 7:64838234-64838256 CAGCGGCCGCTCCGAGGCCGGGG + Intergenic
1026127042 7:67588155-67588177 CTGTGCCAGTTTCCAGGCCCAGG + Intergenic
1026523145 7:71133124-71133146 GTGTGCCGGCTCCCAGGCACAGG - Intronic
1026734154 7:72938637-72938659 CTCCTCCCGCTCCCAGACACCGG + Exonic
1026807701 7:73438179-73438201 CTGCCCTCCCTCCCAGGTCCTGG - Intergenic
1027150249 7:75728493-75728515 CTGTGCCCGCTGCCACACCCAGG + Intronic
1028571411 7:92291611-92291633 CTGCGCTCCAGCCCAGGCCCAGG - Intronic
1029473075 7:100766769-100766791 CTGCTGCCCCTCCCAGGCCCTGG - Intronic
1032125406 7:129189266-129189288 CCGCCCGCGCTCCGAGGCCCAGG - Exonic
1032130720 7:129225251-129225273 CGGCCCCCGGTCCCCGGCCCGGG + Exonic
1033113929 7:138608551-138608573 CTGTGCCCTCTTCCAGGCCGTGG - Intronic
1033223630 7:139544471-139544493 CAGGCCCCTCTCCCAGGCCCTGG + Exonic
1033339262 7:140479215-140479237 CTCCGCCCGCCCCCAGGGACGGG + Exonic
1033595333 7:142854929-142854951 CGGCGCCCGCTCCTCCGCCCCGG - Intergenic
1034342714 7:150368684-150368706 GGGCGCCCGCGCCCCGGCCCCGG + Intronic
1034447608 7:151121570-151121592 CTCCGCCCACGCCCAGTCCCCGG + Intronic
1035166798 7:156995373-156995395 CTGCGCCTGCACCAAGCCCCTGG - Intronic
1035203319 7:157279893-157279915 CGGCGGCCGCTCCCAGGTCAGGG - Intergenic
1035209017 7:157314123-157314145 CAGAGCCCGCTCCCAGGGCTGGG - Intergenic
1035622650 8:1045636-1045658 CCGCGCCCCCACCCAGGTCCTGG + Intergenic
1035931053 8:3780619-3780641 CTGGGCCTGCTCCCAGCTCCTGG + Intronic
1036441204 8:8782533-8782555 ATGCGCCCCCTCCCAAGCGCTGG + Intergenic
1037450647 8:19013533-19013555 CCGCGCCCGCGCCCCGGCCCCGG + Intronic
1037834923 8:22210036-22210058 CTGCCCCCCATTCCAGGCCCTGG - Intronic
1037901558 8:22692167-22692189 CTTCCCCAGCTCCCCGGCCCCGG + Intronic
1037907514 8:22724227-22724249 CCGCTCCTGCTCCCTGGCCCTGG + Intronic
1038288887 8:26230864-26230886 CTGCCCCCTCTCCCTGCCCCAGG + Intergenic
1039825674 8:41172230-41172252 AGGCGCCCGCCACCAGGCCCAGG + Intergenic
1040471466 8:47738337-47738359 CGGGGCCCCCTCCCCGGCCCTGG + Exonic
1041355319 8:56993695-56993717 TGGCGCCCGCTCCCCGGCCCCGG + Exonic
1046858121 8:119058420-119058442 CTGCTCCCACTCTCAGCCCCAGG + Intronic
1047510745 8:125513454-125513476 CAGCCCCCGCTCCCAGGTCCAGG - Intergenic
1047615277 8:126557993-126558015 CCGCGCCCGCCCTCAGGCTCGGG + Intronic
1048203892 8:132400512-132400534 CGGAGCCAGCTCCTAGGCCCTGG + Intronic
1049237259 8:141518562-141518584 CTGCGCCCGCGCGCGGGGCCCGG + Exonic
1049238845 8:141526304-141526326 CTGTGCCCAGTCCCAGGCCAAGG + Intergenic
1049406092 8:142452433-142452455 CTGCGCCCCCTCCCTAGCCCGGG - Intronic
1049444150 8:142622376-142622398 CATCCCCTGCTCCCAGGCCCTGG + Intergenic
1049583762 8:143423793-143423815 CTGAGCAGGCACCCAGGCCCAGG + Intronic
1049596242 8:143484824-143484846 ATCCCCCCACTCCCAGGCCCTGG + Intronic
1049640013 8:143711256-143711278 CTGAGCCCGCCCCCAAGGCCAGG - Intronic
1049708234 8:144052442-144052464 CTGCGCCGCCTCCCAGGTGCGGG - Exonic
1049777760 8:144414297-144414319 CTGCACCCACTGCCAGGCTCAGG + Exonic
1049782202 8:144434202-144434224 CAGCGCCTGCTCCCTGGCCCTGG - Exonic
1049790983 8:144472633-144472655 CAGCTCCCGCTCGCATGCCCTGG + Exonic
1049848727 8:144819465-144819487 CTTCTCCCGCTCCCTGCCCCAGG + Intergenic
1053886881 9:42650234-42650256 CTGTGCCAGCTGCCAGCCCCCGG + Intergenic
1054225900 9:62457684-62457706 CTGTGCCAGCTGCCAGCCCCCGG + Intergenic
1056187409 9:84149136-84149158 CTGCTACCCTTCCCAGGCCCTGG + Intergenic
1056643317 9:88388730-88388752 GCGCGCCCGCCCCGAGGCCCAGG - Intronic
1056773748 9:89497538-89497560 CACCGCCCCCTCCCTGGCCCGGG + Intronic
1056800161 9:89685563-89685585 CTGTGCCCACTCCCATGCTCTGG - Intergenic
1057227381 9:93299567-93299589 CGGCGCCAGTTCCCAGGCACTGG + Intronic
1057333784 9:94140846-94140868 CTGCTCCCCATCCCAGGGCCTGG + Intergenic
1057432192 9:95004802-95004824 GTGCTCCCGCTCCCGGGCTCCGG - Intronic
1057724224 9:97556852-97556874 CTCCTGCCGCTCCCAAGCCCTGG - Intronic
1057869686 9:98708606-98708628 CCGCGCCCAGCCCCAGGCCCCGG + Exonic
1060313187 9:122482845-122482867 CTGCTCACCCTCCCAGGCTCTGG - Intergenic
1060985234 9:127815806-127815828 CTGCCCCCGCTCCCGCTCCCAGG - Exonic
1061100022 9:128485290-128485312 ATGAGCCCGCTCCCAGCTCCTGG + Intronic
1061139107 9:128753594-128753616 CTGTGCCCACTCCCAGGACCTGG - Exonic
1061201450 9:129140740-129140762 CTGTGCACACTTCCAGGCCCAGG - Intronic
1061449489 9:130660680-130660702 CCTCCCCCGCACCCAGGCCCGGG + Intergenic
1061610266 9:131740932-131740954 ATGAGGCCACTCCCAGGCCCTGG - Intergenic
1061780143 9:132991053-132991075 CTGCGCCGGCTCCCAGCTCCTGG + Exonic
1061800995 9:133113360-133113382 CTGCGCACCCTCAGAGGCCCAGG + Intronic
1061868950 9:133509965-133509987 CTGCTTCTGCTCCCAGGCTCGGG + Intergenic
1061884297 9:133583864-133583886 CGGCGCCAGGTCCCAGGGCCAGG + Intronic
1062132789 9:134909014-134909036 CTTCTCCAGCTCCCAGGCCAGGG - Intronic
1062137044 9:134934717-134934739 CTCCCCCAGCACCCAGGCCCAGG + Intergenic
1062325458 9:136010488-136010510 CTGCTCCCCCGCCCAGGGCCAGG - Exonic
1062331980 9:136048897-136048919 ATGCACCCGCACCCAGGCCCAGG + Intronic
1062340068 9:136090215-136090237 CAGGGCCCCCACCCAGGCCCTGG - Intronic
1062388823 9:136326108-136326130 CTCTGCCCGCAGCCAGGCCCAGG + Intergenic
1062551495 9:137089538-137089560 CTGCTCCCTCTCCCAGCCCTGGG - Intronic
1062617608 9:137405066-137405088 CTGTGTCCCCTCCCAGCCCCTGG - Intronic
1203469338 Un_GL000220v1:109334-109356 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1203477159 Un_GL000220v1:153306-153328 CGGCGCCCGCCCCCCGGCCGGGG - Intergenic
1185545190 X:937927-937949 CTGCACCCTCTCCCAACCCCAGG + Intergenic
1185642369 X:1595569-1595591 CTGCGCACACTCCCAGGTGCCGG - Intronic
1186496173 X:10014684-10014706 CTTCACCCGCTCCCGGGCTCTGG - Intergenic
1186669841 X:11757868-11757890 GAGCGCCCGCTCTCCGGCCCGGG - Intergenic
1186826507 X:13345673-13345695 CTTCCCCCGCTTCCAGTCCCTGG - Intergenic
1190325953 X:49206902-49206924 GTGCCCCATCTCCCAGGCCCAGG - Intronic
1192429221 X:71101307-71101329 CTTCTCCAGCTCCCAGGCTCTGG + Exonic
1192533720 X:71911065-71911087 CTGCGCCCGCGCCCGCGGCCGGG + Intergenic
1193018973 X:76769516-76769538 CTCCACCCGCTGACAGGCCCTGG + Intergenic
1195031131 X:100928787-100928809 CTGCGCCCGCTCTTCTGCCCTGG - Exonic
1195716844 X:107826319-107826341 CGGCGCGAGCTCCCGGGCCCCGG - Exonic
1195744199 X:108098115-108098137 CTTCGCCCCCTGACAGGCCCTGG + Intronic
1196744821 X:119061947-119061969 CTGCCCTCACTCCCAGCCCCTGG - Intergenic
1197726669 X:129781289-129781311 CTGCCCCAGCTCTCAGGTCCTGG + Intronic
1197749909 X:129957273-129957295 CTCCGCCCCTGCCCAGGCCCCGG + Intergenic
1199977077 X:152900458-152900480 CTGCCCCCACTGCCAGTCCCTGG + Intergenic
1200044610 X:153394586-153394608 CTGGGACAGCTCCCATGCCCTGG + Intergenic
1200085570 X:153602863-153602885 CTGTGCTCCCTCCCTGGCCCTGG - Intergenic
1200218331 X:154378623-154378645 CTTCGCCCGCTCGCACGTCCCGG + Intergenic