ID: 946185523

View in Genome Browser
Species Human (GRCh38)
Location 2:217978628-217978650
Sequence CGCTTTGCATAAACAAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 98}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185518_946185523 -6 Left 946185518 2:217978611-217978633 CCGCTCCCAGGCCCAGGCGCTTT 0: 1
1: 0
2: 3
3: 31
4: 353
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185515_946185523 1 Left 946185515 2:217978604-217978626 CCTGCGCCCGCTCCCAGGCCCAG 0: 1
1: 0
2: 8
3: 103
4: 811
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185511_946185523 19 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185513_946185523 7 Left 946185513 2:217978598-217978620 CCTTGACCTGCGCCCGCTCCCAG 0: 1
1: 0
2: 0
3: 43
4: 238
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185510_946185523 24 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185507_946185523 27 Left 946185507 2:217978578-217978600 CCCCCGGGCCTTCGCCTTCACCT 0: 1
1: 0
2: 2
3: 11
4: 179
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185517_946185523 -5 Left 946185517 2:217978610-217978632 CCCGCTCCCAGGCCCAGGCGCTT 0: 1
1: 0
2: 4
3: 94
4: 2027
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185512_946185523 13 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185509_946185523 25 Left 946185509 2:217978580-217978602 CCCGGGCCTTCGCCTTCACCTTG 0: 1
1: 0
2: 2
3: 31
4: 240
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185506_946185523 30 Left 946185506 2:217978575-217978597 CCGCCCCCGGGCCTTCGCCTTCA 0: 1
1: 0
2: 0
3: 22
4: 230
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98
946185508_946185523 26 Left 946185508 2:217978579-217978601 CCCCGGGCCTTCGCCTTCACCTT 0: 1
1: 0
2: 3
3: 10
4: 141
Right 946185523 2:217978628-217978650 CGCTTTGCATAAACAAAGAGAGG 0: 1
1: 0
2: 0
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185523 Original CRISPR CGCTTTGCATAAACAAAGAG AGG Intronic