ID: 946185525

View in Genome Browser
Species Human (GRCh38)
Location 2:217978634-217978656
Sequence GCATAAACAAAGAGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 486}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185512_946185525 19 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185520_946185525 -6 Left 946185520 2:217978617-217978639 CCAGGCCCAGGCGCTTTGCATAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185519_946185525 -5 Left 946185519 2:217978616-217978638 CCCAGGCCCAGGCGCTTTGCATA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185510_946185525 30 Left 946185510 2:217978581-217978603 CCGGGCCTTCGCCTTCACCTTGA 0: 1
1: 0
2: 1
3: 22
4: 224
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185518_946185525 0 Left 946185518 2:217978611-217978633 CCGCTCCCAGGCCCAGGCGCTTT 0: 1
1: 0
2: 3
3: 31
4: 353
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185515_946185525 7 Left 946185515 2:217978604-217978626 CCTGCGCCCGCTCCCAGGCCCAG 0: 1
1: 0
2: 8
3: 103
4: 811
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185511_946185525 25 Left 946185511 2:217978586-217978608 CCTTCGCCTTCACCTTGACCTGC 0: 1
1: 0
2: 0
3: 42
4: 328
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185513_946185525 13 Left 946185513 2:217978598-217978620 CCTTGACCTGCGCCCGCTCCCAG 0: 1
1: 0
2: 0
3: 43
4: 238
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486
946185517_946185525 1 Left 946185517 2:217978610-217978632 CCCGCTCCCAGGCCCAGGCGCTT 0: 1
1: 0
2: 4
3: 94
4: 2027
Right 946185525 2:217978634-217978656 GCATAAACAAAGAGAGGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 486

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185525 Original CRISPR GCATAAACAAAGAGAGGAGG AGG Intronic