ID: 946185528

View in Genome Browser
Species Human (GRCh38)
Location 2:217978645-217978667
Sequence GAGAGGAGGAGGGACGCCCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 412}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185517_946185528 12 Left 946185517 2:217978610-217978632 CCCGCTCCCAGGCCCAGGCGCTT 0: 1
1: 0
2: 4
3: 94
4: 2027
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185518_946185528 11 Left 946185518 2:217978611-217978633 CCGCTCCCAGGCCCAGGCGCTTT 0: 1
1: 0
2: 3
3: 31
4: 353
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185519_946185528 6 Left 946185519 2:217978616-217978638 CCCAGGCCCAGGCGCTTTGCATA 0: 1
1: 0
2: 0
3: 6
4: 117
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185522_946185528 -1 Left 946185522 2:217978623-217978645 CCAGGCGCTTTGCATAAACAAAG 0: 1
1: 0
2: 0
3: 10
4: 112
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185512_946185528 30 Left 946185512 2:217978592-217978614 CCTTCACCTTGACCTGCGCCCGC 0: 1
1: 0
2: 0
3: 7
4: 150
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185521_946185528 0 Left 946185521 2:217978622-217978644 CCCAGGCGCTTTGCATAAACAAA 0: 1
1: 0
2: 0
3: 9
4: 114
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185515_946185528 18 Left 946185515 2:217978604-217978626 CCTGCGCCCGCTCCCAGGCCCAG 0: 1
1: 0
2: 8
3: 103
4: 811
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185520_946185528 5 Left 946185520 2:217978617-217978639 CCAGGCCCAGGCGCTTTGCATAA 0: 1
1: 0
2: 0
3: 11
4: 124
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412
946185513_946185528 24 Left 946185513 2:217978598-217978620 CCTTGACCTGCGCCCGCTCCCAG 0: 1
1: 0
2: 0
3: 43
4: 238
Right 946185528 2:217978645-217978667 GAGAGGAGGAGGGACGCCCCGGG 0: 1
1: 0
2: 2
3: 43
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185528 Original CRISPR GAGAGGAGGAGGGACGCCCC GGG Intronic