ID: 946185746

View in Genome Browser
Species Human (GRCh38)
Location 2:217979566-217979588
Sequence TTCCAGCTTCTGGTAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185746_946185752 8 Left 946185746 2:217979566-217979588 CCTCCCATTACCAGAAGCTGGAA 0: 1
1: 0
2: 3
3: 30
4: 261
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185746_946185750 -6 Left 946185746 2:217979566-217979588 CCTCCCATTACCAGAAGCTGGAA 0: 1
1: 0
2: 3
3: 30
4: 261
Right 946185750 2:217979583-217979605 CTGGAATCAAATTTCCTATAAGG 0: 1
1: 0
2: 0
3: 20
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185746 Original CRISPR TTCCAGCTTCTGGTAATGGG AGG (reversed) Intronic
900790870 1:4679634-4679656 TTCCAGCTTCTGGTGGTTGCTGG + Intronic
902754759 1:18541559-18541581 TTCCAGCTTCTGGTGGTGGCCGG + Intergenic
905423880 1:37867860-37867882 CACCAGCTTCTGGGAATGGGTGG - Intronic
905791633 1:40792637-40792659 TTCCAGCCTCTGGGGATTGGTGG + Intronic
905901158 1:41582739-41582761 TTTCAGCTTCTGGAGATGTGTGG + Exonic
906817283 1:48892134-48892156 TTCCAGCTTCTGGTGGTTGCTGG + Intronic
908858234 1:68453116-68453138 TTTCAGCCTCTTGTAATGGGAGG - Intergenic
908909169 1:69052859-69052881 TTCAAGCATCTGGCAATAGGCGG - Intergenic
910044087 1:82890678-82890700 TTCAAGCTTATGGAAAAGGGAGG + Intergenic
910219521 1:84876370-84876392 TTCCAGCTTCTGCCAATGAGAGG + Intronic
914408505 1:147401921-147401943 TAGCAGCATCTGGTTATGGGAGG + Intergenic
914877725 1:151524798-151524820 TTCCACCTCCTGGTCACGGGAGG - Exonic
918415422 1:184301250-184301272 TTCCAGTTTCTGGGAATAGCAGG + Intergenic
918431065 1:184461262-184461284 TTTCAGCTTCTAATAAGGGGTGG + Intronic
919707458 1:200690992-200691014 TTCCAGCTTAGGGTAATTGATGG + Intergenic
919993937 1:202730294-202730316 CTCCATCTTCTGGTATTGGTTGG - Intronic
922098488 1:222462457-222462479 TTCCAGCTTCTGGCACTGCCAGG - Intergenic
923499320 1:234551251-234551273 ATCCAGCTTCTGGTCATCCGAGG + Intergenic
923728304 1:236526369-236526391 TGCCAACTTTTGGTGATGGGAGG + Intronic
1063073749 10:2693104-2693126 TTTCAGCATGTGGTTATGGGAGG - Intergenic
1063975936 10:11415578-11415600 TTCCTGCTTCTGGCAGTAGGAGG + Intergenic
1064316058 10:14257758-14257780 TTCTAGCTTCTGGTGGCGGGTGG - Intronic
1065134497 10:22654657-22654679 GTCCAGCTGCTGGTCATGGTGGG + Intronic
1067370036 10:45674031-45674053 ATGGAGCTTCTGGTATTGGGAGG - Intergenic
1068491623 10:57731716-57731738 TTCCAGCATTTGGTTAGGGGTGG + Intergenic
1069827329 10:71262252-71262274 TTCCAGGCTCCGGTAATGAGGGG - Intronic
1069880171 10:71587643-71587665 TTCCAGGTTATGGGCATGGGAGG + Intronic
1070816621 10:79328509-79328531 CTCCAGCTCCTGGTAATGGCCGG - Intergenic
1071811737 10:89189484-89189506 TTACAGGTACTGGTAATGGCAGG + Intergenic
1073167946 10:101474441-101474463 TTCCAGCTGCTGCTCATGGGGGG - Intronic
1073486403 10:103821680-103821702 TCCCAGCTACTGGTGGTGGGGGG - Intronic
1073888956 10:108074964-108074986 TTCCAGCTTCCTGTGTTGGGTGG + Intergenic
1076192210 10:128490795-128490817 TTCCAGCTTCTGATGGTGGCAGG + Intergenic
1077061361 11:619154-619176 CTCCAGCCTCTGGGGATGGGGGG + Exonic
1078168682 11:8911766-8911788 TTCCAGCTTCCGCTAAGGGAAGG - Intronic
1079937995 11:26641783-26641805 TTCCAGCTCCTCGGAATTGGAGG - Intronic
1081091335 11:38869510-38869532 GTCCAGCATCTAGTAATAGGAGG - Intergenic
1083072876 11:60004555-60004577 TTAAAGTTTCTGGTAATGGCAGG + Intergenic
1084735886 11:71105048-71105070 TTCCAGCTTTTGGCAATTGTGGG - Intronic
1085473036 11:76770157-76770179 TTCCAGCCTCTGGAACTGCGAGG - Intergenic
1086754045 11:90535762-90535784 TTCCAGCTTTTGCCATTGGGAGG + Intergenic
1087013222 11:93532723-93532745 TTCCAGCTTCTGGTGGTTGCTGG - Intronic
1087104326 11:94395132-94395154 TTCCAGCATCTGGTAAGGAATGG - Intronic
1087986498 11:104688191-104688213 TCCTAGCTTCTGGTAGTGGCTGG + Intergenic
1088003927 11:104917867-104917889 TTTCAGCTTCTGGTAATCAAAGG - Intergenic
1088008223 11:104968271-104968293 TTTCAGCTTCTGGTAATCAAAGG - Intronic
1088017631 11:105080144-105080166 TTTCAGCTTCTGGTAATCAAAGG - Intronic
1088157409 11:106824395-106824417 TTCCAGTTTCTTGGAATGGGAGG + Intronic
1088160356 11:106862692-106862714 TTCCAGTTTCTGGTCAGGGAAGG - Intronic
1089003206 11:115069117-115069139 TTCCAGCTTCTGGCTGTGGCCGG - Intergenic
1089669556 11:120044045-120044067 TCCTAGCCTCTGGTGATGGGAGG + Intergenic
1091769860 12:3144494-3144516 TTCTAGCTTCTGGTCATTGCTGG - Intronic
1091802877 12:3335522-3335544 TTCCAGCTTCTGAGAGTGGCTGG - Intergenic
1093323491 12:17743286-17743308 TTCTAGCTTCTGGTATTAGCTGG - Intergenic
1093475441 12:19549483-19549505 TTCCAGCATCTGGTAGTGCCAGG + Intronic
1093636104 12:21470735-21470757 TTCCAGTTTCTTGGAATGGGAGG - Exonic
1093801847 12:23383017-23383039 TTCCAGCTTCTGGTAGTTGTTGG - Intergenic
1093997138 12:25654772-25654794 TTCCAGCCTCTGGAACTGTGAGG - Intergenic
1095574593 12:43721735-43721757 TTCCAGCCAATGGGAATGGGAGG + Intergenic
1097445854 12:59670114-59670136 TTCCAGCTTCTGGTAAACCCAGG + Intronic
1097987366 12:65798081-65798103 TTCCAGCTTCTGGTGACAGCTGG - Intergenic
1098381915 12:69878902-69878924 TTCCAGGTGCTGGGCATGGGGGG - Intronic
1098876056 12:75867453-75867475 TTGCAGATTCTGGTACAGGGTGG - Intergenic
1099507447 12:83497172-83497194 TTCTAGCTTCTGGTAATTCCTGG + Intergenic
1101180177 12:102207836-102207858 TTCCAGCTTCTGGTGACTGTTGG + Intergenic
1105538830 13:21297162-21297184 TTCCAGCTTCTGGCAGCTGGTGG + Intergenic
1105799422 13:23890402-23890424 TTCCAGCTTCTGGCAGCTGGTGG - Intergenic
1105849626 13:24322636-24322658 TTCCAGCTTCTGGCAGCTGGTGG + Intergenic
1106221665 13:27750898-27750920 TTACAGCTTATGGAAATGGCTGG + Intergenic
1106650647 13:31686575-31686597 TTCCAGCTTCTGGTGTTTGCTGG + Intergenic
1108123889 13:47219867-47219889 TTCCAGCTTCTGGTCCTTGCTGG + Intergenic
1110019093 13:70446350-70446372 TTCCAGCTTTGGGCACTGGGAGG + Intergenic
1111739643 13:92187565-92187587 TGCCACCTTCTGGTAAAGAGAGG - Intronic
1112582207 13:100686244-100686266 TCCCAGCTTCTGGTAGTTGCTGG + Intergenic
1113032603 13:106010872-106010894 ATCCAGCTTCTGGTGATGGTCGG - Intergenic
1113068215 13:106392965-106392987 TTCCAGCTTCTGGTGTTTGCTGG + Intergenic
1113367847 13:109693401-109693423 CTCCAGCTTCTGGTGGTGGCTGG - Intergenic
1115934288 14:38534207-38534229 TTCTAGCCTCTGGTGATGGATGG - Intergenic
1116346090 14:43796380-43796402 TTCTAGCTTCTGGTATTTGCTGG - Intergenic
1120465841 14:84856079-84856101 TTCCAGCTTCTGGCAGTGACAGG - Intergenic
1120739772 14:88095200-88095222 TCCTAGCTTCTGGTGATGGCTGG + Intergenic
1124568092 15:30834480-30834502 TGCCAGCTGCTGGTAAGGGAGGG + Intergenic
1125177439 15:36840896-36840918 TTGCAGCTTCTGGGAAGAGGTGG + Intergenic
1126648754 15:50900815-50900837 TTCCAGCTTTTGGTAACTGCTGG + Intergenic
1127848667 15:62894303-62894325 TTCCAGCATCTGGAACTGTGAGG - Intergenic
1133502125 16:6376473-6376495 TTCCAGTTTCTGGTAGTTGCTGG + Intronic
1134452268 16:14370849-14370871 GTCCAGCTTCTGAGAAGGGGGGG + Intergenic
1136060321 16:27721877-27721899 TTCCGGCTGCTGGTGTTGGGAGG + Intronic
1139245097 16:65433776-65433798 TTCCAGCTTTTGAAGATGGGTGG - Intergenic
1140017279 16:71199680-71199702 TTTCTGCTTCTGATAATGGTAGG - Intronic
1140871935 16:79114532-79114554 TTCCAGCTCCTGGTGGTGGATGG - Intronic
1145875866 17:28318049-28318071 CTCCAGCCTCAGGTCATGGGAGG - Intergenic
1146551639 17:33785293-33785315 TTCCAGCCTCTGGAACTGTGAGG + Intronic
1146770289 17:35562540-35562562 TTCCAGCTTCTGGTAGCTGCTGG - Intergenic
1149447449 17:56724645-56724667 CTCCAGGCCCTGGTAATGGGAGG + Intergenic
1150444569 17:65218745-65218767 TTCCAGCTTCTGTGAATAGAGGG + Intronic
1150898177 17:69238180-69238202 TTCTAGCTTCTGGTAGTTGCTGG - Intronic
1151163038 17:72181943-72181965 TTACAGATTGTGGTAATGGCTGG - Intergenic
1151725291 17:75880215-75880237 TCCCAGCTTCTGGTACTGGCTGG + Intergenic
1153046096 18:856938-856960 TTCCAGCTTCTGCTGCTGGCTGG - Intergenic
1153637134 18:7122438-7122460 ATCCAGGTTCTGGTCATTGGTGG + Intergenic
1153784294 18:8520676-8520698 TTCCAGCTTCTGGTAGCTGTTGG - Intergenic
1154056546 18:11018109-11018131 TTCCAGCTTTGGGTAGTGGCCGG + Intronic
1154060633 18:11056314-11056336 TCCCAGCTGCTGGGAATGGGAGG + Intronic
1154482132 18:14841067-14841089 TGCCAAATTTTGGTAATGGGAGG - Intronic
1157443474 18:47727713-47727735 TTCCAGCTTCTAGTAGTTGCTGG - Intergenic
1159120105 18:64159082-64159104 TTCCATCATCTGGAAATGTGAGG - Intergenic
1159462841 18:68742190-68742212 TTTTAGCTTCTGGTGATGGCTGG + Intronic
1159665178 18:71149795-71149817 TTCCAGCTTCTGGTGATTGCTGG - Intergenic
1160287620 18:77559612-77559634 TTCCAGCTTCTGGTGATGGCCGG + Intergenic
1160683448 19:423101-423123 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683472 19:423162-423184 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683496 19:423223-423245 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683520 19:423284-423306 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683544 19:423345-423367 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683568 19:423406-423428 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683592 19:423467-423489 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683616 19:423528-423550 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683642 19:423589-423611 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1160683666 19:423650-423672 CTCCAGCTCCTGGTCCTGGGGGG + Intronic
1161127437 19:2566313-2566335 TCCCAGCTCCTGGTGATGGCCGG - Intronic
1161311090 19:3594582-3594604 TTCCAGCAGCCTGTAATGGGAGG - Intronic
1162952664 19:14081216-14081238 TTCCAGCTTTTGGGACTTGGGGG - Intergenic
1164622653 19:29706408-29706430 TTCCAGTCCCTGGTCATGGGCGG - Intronic
1165279492 19:34784165-34784187 TTCCAGCTTCTGGTGGTTGCTGG + Intergenic
1167100068 19:47399226-47399248 TTCCAGATTCTGGGAAAAGGGGG + Intergenic
925473546 2:4188397-4188419 TTCTAGTTTCTGGTACTGGCTGG + Intergenic
925879111 2:8336117-8336139 TTACAGCTTCTGATAAACGGAGG - Intergenic
926230963 2:11003533-11003555 CTCCAGGTTCTGGTGGTGGGCGG - Intergenic
927111547 2:19867374-19867396 TTCCAGCTTCTGGTGAATGCAGG + Intergenic
928228888 2:29478821-29478843 TCCCAGCTTGTGGGAATGGTAGG + Intronic
928233600 2:29521255-29521277 CTTCAGCTTCTGGCAATGGTAGG + Intronic
933646159 2:84814214-84814236 TTCCTGCTCCTGCCAATGGGAGG - Intronic
933852613 2:86382668-86382690 TTCCAGCTTAGGGGAGTGGGTGG + Intergenic
935129460 2:100250625-100250647 TTCCAGCTTCTGGTGGTTGTCGG - Intergenic
937726370 2:125172342-125172364 TTCCAGCTTCTTATACTGGAAGG + Intergenic
937923031 2:127145810-127145832 TTCCAGCTCCTGGAATTGGAAGG + Intergenic
938419239 2:131130900-131130922 TCCCAGCTACTGGGAAGGGGAGG - Intronic
938622178 2:133067637-133067659 TTCCAGCCTCTGGGAATGTAGGG + Intronic
938701738 2:133885708-133885730 TTCCAGCTTCTGGTAGTACTGGG - Intergenic
938940985 2:136169461-136169483 TTCCATCTTCTGGTAATTAAAGG + Intergenic
940055393 2:149507673-149507695 TTCCAGTTTCTGGGTATGAGGGG - Intergenic
940158125 2:150680961-150680983 TTCCAGCTTCTGGTAGCTGTTGG - Intergenic
941031056 2:160512174-160512196 TTCCAGCTTCTGGTAGCTGTTGG + Intergenic
941459351 2:165750117-165750139 TTCCAACTTCTGGTATGGGGAGG - Intronic
944083902 2:195821787-195821809 TCCCAGCTCCTGCTACTGGGTGG + Intronic
946185746 2:217979566-217979588 TTCCAGCTTCTGGTAATGGGAGG - Intronic
947108391 2:226691960-226691982 GTCCAGCCCCTGGTGATGGGTGG + Intergenic
947377480 2:229511213-229511235 TGCCAGCTTCTGCCACTGGGTGG - Intronic
948210767 2:236191513-236191535 TTCCAGATTCTACCAATGGGAGG + Intergenic
948252835 2:236544339-236544361 TTACAGCTTCTGTGGATGGGGGG + Intergenic
1170742089 20:19067013-19067035 TTCCAGCCTCTGGAACTGTGAGG + Intergenic
1171059024 20:21937867-21937889 TTCCAGTTCATGGTCATGGGTGG - Intergenic
1171414804 20:24970212-24970234 TACCTGCTTCTGGTGATGGAGGG - Exonic
1172174460 20:32963658-32963680 TTCCAGCTTCTGGTGTTTGCTGG + Intergenic
1173906736 20:46634954-46634976 TTGCAGCTGGTGCTAATGGGAGG + Intronic
1174504197 20:51006042-51006064 CTCCTGCTTATGGTGATGGGGGG + Intronic
1175110529 20:56644899-56644921 TTCCAGCTTCTGGTGGTAGCTGG - Intergenic
1175582984 20:60114794-60114816 TTCCAGCTTCTGGTGGTTGCTGG - Intergenic
1176389745 21:6157352-6157374 TTTCAGCTGCTGGTCATGGTGGG + Intergenic
1176940870 21:14923922-14923944 TTCCAGCTTACTGTAATTGGTGG - Intergenic
1179443093 21:41409687-41409709 TTCCAGCCTCTGGAGGTGGGAGG - Intergenic
1179733722 21:43380886-43380908 TTTCAGCTGCTGGTCATGGTGGG - Intergenic
1180568025 22:16691806-16691828 TTCAAGTTTCTGCTCATGGGAGG - Intergenic
1182062936 22:27410806-27410828 TGTCAGCTTCAGGTAATGGAAGG - Intergenic
1182808407 22:33095289-33095311 TTCCAGCTTCTGATGATTGTCGG + Intergenic
1183002567 22:34873823-34873845 TTCCAGCTTCTGGTGGTTGCTGG + Intergenic
1183210521 22:36448502-36448524 TTCCATCTGGTGGGAATGGGAGG + Intergenic
1185017417 22:48352821-48352843 CTCCAGCCTCTGGGGATGGGAGG - Intergenic
1185118508 22:48951809-48951831 TTCCAGCTTCTGGTGATGCCCGG - Intergenic
949328016 3:2888918-2888940 TTACAGCTTCTGGCCAAGGGAGG + Intronic
949409215 3:3745564-3745586 TTCTAGCTTCTGGTATTTGCTGG + Intronic
953382990 3:42488199-42488221 ATCCAGCTTCTGGTAGTTGCTGG - Intergenic
955604326 3:60684214-60684236 TTTCAGCTTCTGGTGGTTGGTGG + Intronic
955641182 3:61086750-61086772 TTTCTGCTTCTGGTAATGATAGG - Intronic
955719303 3:61864808-61864830 TTCCATCTCCTCGTAATGTGTGG + Intronic
956054622 3:65285577-65285599 TTCCAGTTTCTGGAAAAAGGGGG + Intergenic
956964593 3:74444013-74444035 TTCTAGCTTCTGGTAGTTGCTGG + Intronic
957547319 3:81656373-81656395 TTTCAGCTTCTGGAAGTGGCTGG - Intronic
957953721 3:87157123-87157145 CTCCAGCTTCTGGTAGTGCCAGG - Intergenic
957967137 3:87336931-87336953 TAGCAGCTGCTGGTAATGAGAGG - Intergenic
958740734 3:98067650-98067672 TTCCAGCTTCTGGTAATCCCTGG - Intergenic
959498336 3:107076740-107076762 TTCCAGCCTCTAGAAATGTGAGG - Intergenic
960237078 3:115296002-115296024 CTCCAGCTTCTGGGAATTGCAGG - Intergenic
961352563 3:126313295-126313317 TTCCAGCCTCTGGAACTGTGGGG + Intergenic
961443225 3:126965208-126965230 TTCCAGCTTCCCGCCATGGGAGG - Intergenic
961829617 3:129616754-129616776 GTCCAGCTTCTGGCCTTGGGGGG + Intergenic
962692522 3:137914121-137914143 GTCCAGCTTCTTGACATGGGTGG - Intergenic
962733297 3:138302425-138302447 TTCAAGCTTTTGGGAATGGGGGG - Intronic
963028279 3:140941832-140941854 TTTCAGCCTCTGGTGAAGGGCGG + Intronic
965463023 3:168992359-168992381 TTTCATCTTCTGGTAATGGTAGG + Intergenic
968281497 3:197480353-197480375 TTCTAGCTTCTGGTAACTGCAGG + Intergenic
970894205 4:21083625-21083647 TTCCAGCTTCTGGTAATTCCAGG - Intronic
971744206 4:30558352-30558374 TTCCAGCTTCTGGAAGTTGCTGG - Intergenic
973600471 4:52537807-52537829 TTCCAGCTTCTGGTATAAGCAGG + Intergenic
974821372 4:67070692-67070714 TCCAAGCTTCTGGTAGTTGGAGG - Intergenic
976137987 4:81959699-81959721 TTCCAGCTTCTGGTTGGGAGTGG + Intronic
976204011 4:82607380-82607402 TTCTAGCTTCTGGTAGTTGCTGG - Intergenic
976660493 4:87535519-87535541 TTCCAGCCTCTAGAACTGGGAGG - Intergenic
980300208 4:130981599-130981621 TCCTATCTTCTGGTAATGGCTGG - Intergenic
985369201 4:189267462-189267484 CTCCAGCTGCTGCTACTGGGAGG - Intergenic
985961742 5:3307752-3307774 TTCCAGCTCCTGGTAGTCGCTGG + Intergenic
986240656 5:5956776-5956798 TTTCTGCTTCTTGTCATGGGAGG + Intergenic
986422916 5:7601984-7602006 TTCCAGCTTCTGGTGATGCTGGG + Intronic
987030689 5:13974242-13974264 TCCCAGCTACTTGTGATGGGAGG - Intergenic
987179108 5:15347847-15347869 TTCCAGCTTCTGGTATTTGCTGG - Intergenic
987305284 5:16631893-16631915 ATCCAGCATCTGATAATTGGTGG - Intergenic
989118295 5:37978010-37978032 TTCCAGCTTCTGGTGCTTGCTGG + Intergenic
990335115 5:54764787-54764809 TTCCAGCTTCTGGTGTTGCTGGG + Intergenic
990494918 5:56337882-56337904 TCCCAGCTTCTGGTGATGGATGG + Intergenic
991123782 5:63046654-63046676 TTCCAGTTTAAGGTCATGGGTGG + Intergenic
991428610 5:66518933-66518955 CTCATGCTTCCGGTAATGGGAGG - Intergenic
993219475 5:85072518-85072540 CTCCACCTTCTGTTAATGTGTGG + Intergenic
994849867 5:105040475-105040497 TTCCTGCTTCAGCAAATGGGCGG + Intergenic
995299397 5:110559851-110559873 TTCTAGCTTCTAGTGATGGCTGG + Intronic
996384311 5:122894706-122894728 TTACTGCTTCTGGTAAGGGATGG + Intronic
996405207 5:123097449-123097471 TTCTAGCTTCTGGTTCTTGGTGG + Intronic
997925235 5:138024381-138024403 TTCCAGCTTCTGGTAGTTCCTGG - Intronic
999310668 5:150549672-150549694 TTCCAGATTCTGGTCTTGGATGG + Exonic
1000380290 5:160622774-160622796 TGTCAGCATCTGGTAATGGATGG - Intronic
1001283082 5:170402012-170402034 TTCCAGCTTCTGGTAGTGGCAGG + Intronic
1001751083 5:174131922-174131944 TTCCAGCCTCTGGTGCTGTGAGG + Intronic
1002018150 5:176342512-176342534 TCCCAGCCTCTGGAACTGGGTGG - Intronic
1004816461 6:19316374-19316396 TTTCAGCTTCTGGAACTGTGAGG + Intergenic
1005277217 6:24231823-24231845 TTGCAGCTTCTTGTCATGGGAGG - Intronic
1005909210 6:30293613-30293635 TTCTTGCTTCAGGTAATGGTAGG - Intergenic
1007315092 6:40981263-40981285 TGCCAGCAGCTGGAAATGGGTGG + Intergenic
1008129365 6:47702884-47702906 TACCAGTTTCTGGTAAAGAGTGG - Intronic
1010648050 6:78417404-78417426 TTCTAGCTTCTGGTGATGCCTGG - Intergenic
1011802159 6:91029437-91029459 TTCCAGCTGGTGGTAATAGCGGG + Intergenic
1011906035 6:92369316-92369338 TTCCAGCTTCTGGTGGTTGCTGG - Intergenic
1019400625 7:850821-850843 TTCCTGCTTTTTGTAATGTGAGG + Intronic
1021076062 7:16305995-16306017 TCCTAGCTTCTGGTGATGGCTGG + Intronic
1021554896 7:21909343-21909365 TTCTAGCTTCTGGTCATGGAAGG - Intronic
1022436476 7:30390723-30390745 TTCCAGTTTCTGGTGATGGCTGG + Intronic
1023871003 7:44263048-44263070 CTCCAGCTTCTGGTGATCTGGGG + Exonic
1024185546 7:46944959-46944981 TTCCAGCCTCCAGGAATGGGAGG - Intergenic
1026637838 7:72099525-72099547 TACCAGGTTCTGGTTATGGATGG - Intronic
1028922909 7:96326654-96326676 TGCCAGCTACTGTTAATGGTAGG - Intergenic
1031096842 7:117430298-117430320 TCCCAGCTTCTGGTAGTTGCTGG + Intergenic
1031581881 7:123486176-123486198 TTCCAGTTTCAAGTAATTGGTGG - Intronic
1031884401 7:127230797-127230819 TTCCAGCTTCCAGAAATGTGAGG + Intronic
1032609291 7:133393758-133393780 TCCCAGCCTCTGGAAATGTGAGG + Intronic
1033898030 7:146099339-146099361 TTCCAGCTCCTGAAAATTGGAGG + Intergenic
1035090636 7:156307379-156307401 TTCCACCTGCTGGTTATGGGTGG - Intergenic
1036111516 8:5908156-5908178 TTCCTGCTTCTGAGAGTGGGAGG - Intergenic
1036212743 8:6855345-6855367 TTCCAGCTTCTGTTAATGGCTGG + Intergenic
1037328676 8:17721219-17721241 TTCCTGTTTCTGATAATGGGTGG - Intronic
1037577778 8:20224219-20224241 ATCCAGCTTCTGGTGAAGGTGGG + Intronic
1038310727 8:26444378-26444400 TCCCAGCTTCTGGTAGTTGCTGG + Intronic
1038928762 8:32170058-32170080 TTCCAGCTTCTGGTAACCTCAGG - Intronic
1041570125 8:59328427-59328449 TTCAAGGTTCTGGTAAGAGGAGG - Intergenic
1042193594 8:66212739-66212761 TTCCAGCTTCTGGTAACCACGGG - Intergenic
1042414295 8:68501382-68501404 TTCCAGCCACTGTTACTGGGAGG + Intronic
1043627955 8:82288053-82288075 TTCCAGCTTCTGGTAAGAATTGG + Intergenic
1044826995 8:96208234-96208256 TTCCAGCTCCTGGCACTGGCTGG + Intergenic
1048048349 8:130794104-130794126 TCCCAGCTTCTGGTGGTGGCTGG - Intronic
1048191047 8:132289444-132289466 TTCCAGCTTCTGGTAGCTGCTGG + Intronic
1048458780 8:134602375-134602397 TTCCAGCGCCTGGTACTTGGTGG + Exonic
1048577357 8:135703562-135703584 TTCCAGCCTCTGGTACTGTGAGG + Intergenic
1049626772 8:143626905-143626927 TTCCCGATTCTGGTGATGGCCGG - Intergenic
1050027370 9:1349838-1349860 TTCCAGCTCCTGGTCATTGTGGG - Intergenic
1050250781 9:3742112-3742134 TTCCAGCTTCTGCTAATAGCAGG - Intergenic
1051118618 9:13727293-13727315 TCCTAGCTTCTGGTGGTGGGAGG - Intergenic
1051329679 9:16011015-16011037 CTCCAGCATCTGCAAATGGGAGG + Intronic
1052047768 9:23814353-23814375 TTCCAGGTCCTGGTAATTTGGGG - Intronic
1052085500 9:24260695-24260717 TTCCATCTTTTGGTAAAGTGAGG + Intergenic
1054796690 9:69308813-69308835 TTCCAGCTTCTGGTGGTGCTAGG - Intergenic
1054805589 9:69393522-69393544 ATTCAGTTTCTGGGAATGGGCGG - Intergenic
1055092984 9:72381376-72381398 TTCCAGCTACAGGGAAAGGGAGG + Intergenic
1055588610 9:77785290-77785312 TTCCAGCTTCTGGTGACTGTTGG - Intronic
1055768066 9:79686652-79686674 TTCCAGCTTCTGGTGGTTGCTGG - Intronic
1055968646 9:81889599-81889621 TTCTAGCTTCTGGTAATTGCTGG - Intergenic
1056887425 9:90456941-90456963 TTCCAATTTGTGGTAGTGGGTGG + Intergenic
1057540278 9:95961371-95961393 TTCTAGCTTCTGGTAGTTGCTGG - Intronic
1058431316 9:104922831-104922853 TCCCAGCTACTGGGATTGGGAGG - Intronic
1058766026 9:108183497-108183519 TTCGAGCCTCTGGTGATGGCCGG + Intergenic
1060081351 9:120649574-120649596 TTCCAGTTTAGGGTCATGGGTGG - Intronic
1061867574 9:133501173-133501195 TTCTAGCTGCTGTTAGTGGGAGG - Intergenic
1061905660 9:133695542-133695564 TTCCAGCTGCTGGTGGTGGCCGG - Intronic
1062150237 9:135014397-135014419 TTCCAGCCTCTGGGACTGTGAGG + Intergenic
1062641987 9:137523475-137523497 TTCCATCTTCTAGAAATTGGTGG + Intronic
1185726285 X:2424467-2424489 CTCCAGCCTCTGGAATTGGGAGG + Intronic
1188526007 X:31088534-31088556 TTCCAGTTTAGGGTCATGGGTGG - Intergenic
1189236386 X:39490411-39490433 TTCCAGCTTCTGGTGGTTGCTGG - Intergenic
1190756228 X:53404326-53404348 TCCCTGCTTGTGGTAGTGGGCGG - Intronic
1191939356 X:66461660-66461682 ATCCAGCTTCTGGTTCAGGGAGG + Intergenic
1194706141 X:97178101-97178123 TCCCAGCTGCTGGGGATGGGGGG + Intronic
1194890786 X:99375955-99375977 ACCCAGCTTGTGGTCATGGGTGG - Intergenic
1196519568 X:116657247-116657269 TGCCACCTTCAGGTAATAGGAGG - Intergenic
1196553401 X:117057670-117057692 TTCTAGCTTCTGGTATTTGCTGG + Intergenic
1197822688 X:130557239-130557261 TTCTAGCTTCTGGTATTTGATGG - Intergenic
1198717974 X:139582574-139582596 TTCCAGCTTCTTGTTTTGGCAGG + Intronic
1198886339 X:141342881-141342903 TTCTAGCTTTTGGTAACTGGCGG + Intergenic
1199611162 X:149615891-149615913 TTCCAGCCTCTGGAACTGTGAGG - Intronic