ID: 946185746

View in Genome Browser
Species Human (GRCh38)
Location 2:217979566-217979588
Sequence TTCCAGCTTCTGGTAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185746_946185752 8 Left 946185746 2:217979566-217979588 CCTCCCATTACCAGAAGCTGGAA 0: 1
1: 0
2: 3
3: 30
4: 261
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185746_946185750 -6 Left 946185746 2:217979566-217979588 CCTCCCATTACCAGAAGCTGGAA 0: 1
1: 0
2: 3
3: 30
4: 261
Right 946185750 2:217979583-217979605 CTGGAATCAAATTTCCTATAAGG 0: 1
1: 0
2: 0
3: 20
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185746 Original CRISPR TTCCAGCTTCTGGTAATGGG AGG (reversed) Intronic