ID: 946185747

View in Genome Browser
Species Human (GRCh38)
Location 2:217979569-217979591
Sequence TGATTCCAGCTTCTGGTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185747_946185750 -9 Left 946185747 2:217979569-217979591 CCCATTACCAGAAGCTGGAATCA 0: 1
1: 0
2: 1
3: 14
4: 149
Right 946185750 2:217979583-217979605 CTGGAATCAAATTTCCTATAAGG 0: 1
1: 0
2: 0
3: 20
4: 465
946185747_946185752 5 Left 946185747 2:217979569-217979591 CCCATTACCAGAAGCTGGAATCA 0: 1
1: 0
2: 1
3: 14
4: 149
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185747 Original CRISPR TGATTCCAGCTTCTGGTAAT GGG (reversed) Intronic