ID: 946185747 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:217979569-217979591 |
| Sequence | TGATTCCAGCTTCTGGTAAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 165 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 14, 4: 149} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946185747_946185752 | 5 | Left | 946185747 | 2:217979569-217979591 | CCCATTACCAGAAGCTGGAATCA | 0: 1 1: 0 2: 1 3: 14 4: 149 |
||
| Right | 946185752 | 2:217979597-217979619 | CCTATAAGGTTCCCGAAGCCTGG | 0: 1 1: 0 2: 0 3: 5 4: 54 |
||||
| 946185747_946185750 | -9 | Left | 946185747 | 2:217979569-217979591 | CCCATTACCAGAAGCTGGAATCA | 0: 1 1: 0 2: 1 3: 14 4: 149 |
||
| Right | 946185750 | 2:217979583-217979605 | CTGGAATCAAATTTCCTATAAGG | 0: 1 1: 0 2: 0 3: 20 4: 465 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946185747 | Original CRISPR | TGATTCCAGCTTCTGGTAAT GGG (reversed) | Intronic | ||