ID: 946185748

View in Genome Browser
Species Human (GRCh38)
Location 2:217979570-217979592
Sequence TTGATTCCAGCTTCTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185748_946185752 4 Left 946185748 2:217979570-217979592 CCATTACCAGAAGCTGGAATCAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185748_946185750 -10 Left 946185748 2:217979570-217979592 CCATTACCAGAAGCTGGAATCAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 946185750 2:217979583-217979605 CTGGAATCAAATTTCCTATAAGG 0: 1
1: 0
2: 0
3: 20
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185748 Original CRISPR TTGATTCCAGCTTCTGGTAA TGG (reversed) Intronic