ID: 946185748

View in Genome Browser
Species Human (GRCh38)
Location 2:217979570-217979592
Sequence TTGATTCCAGCTTCTGGTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185748_946185752 4 Left 946185748 2:217979570-217979592 CCATTACCAGAAGCTGGAATCAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185748_946185750 -10 Left 946185748 2:217979570-217979592 CCATTACCAGAAGCTGGAATCAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 946185750 2:217979583-217979605 CTGGAATCAAATTTCCTATAAGG 0: 1
1: 0
2: 0
3: 20
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185748 Original CRISPR TTGATTCCAGCTTCTGGTAA TGG (reversed) Intronic
900744112 1:4349466-4349488 CTGCTTCCAGCTTCTGGTGGAGG + Intergenic
901254760 1:7813284-7813306 TTGCTTCCAGTTTCTGCTCAGGG + Intronic
905159606 1:36020106-36020128 TGGAATACAGCTTCTAGTAATGG + Intronic
906860182 1:49350884-49350906 TTTATTTCAGCTTTAGGTAAGGG + Intronic
907062977 1:51449920-51449942 TTGATTCCAGGGTGTGGAAAAGG + Intronic
907485308 1:54773985-54774007 TTGCTTTCAGTTTCTGGTGAGGG + Intergenic
909763228 1:79320575-79320597 TTAATCCCAGCTACTGGGAAGGG - Intergenic
911384536 1:97158408-97158430 AAGATTTCAACTTCTGGTAATGG + Intronic
911393723 1:97279020-97279042 TTGATTCTAGATTCAGGTGACGG + Intronic
913670454 1:121093388-121093410 CTGGTTCCAGCTACTGGTCATGG - Intronic
914022222 1:143880829-143880851 CTGGTTCCAGCTACTGGTCATGG - Intergenic
914660707 1:149788755-149788777 CTGGTTCCAGCTACTGGTCATGG - Intronic
914838019 1:151224238-151224260 TTGATTCCAGATGCTGCTAGGGG - Exonic
916070972 1:161169705-161169727 GCCATTCCAGCTTCAGGTAATGG + Exonic
916890818 1:169110678-169110700 TTAATTCCATCTTCTGGAACTGG - Intronic
916918091 1:169431804-169431826 TTGATTACTGCTTCTGATCAAGG + Intronic
918501627 1:185202013-185202035 AGGCTTCCAGCTTCTGTTAATGG - Intronic
921215659 1:212934768-212934790 TTGATTCAAGCTACTGTTACTGG + Intergenic
1063470940 10:6284681-6284703 TTGTTTCCAAGTTCTGGGAATGG - Intergenic
1064590513 10:16885373-16885395 TTGATTTCTGCTTCCGCTAATGG - Intronic
1067202679 10:44186880-44186902 TTGGTCCCAGGTTCTGGTAAAGG - Intergenic
1068491621 10:57731712-57731734 TTGGTTCCAGCATTTGGTTAGGG + Intergenic
1069511472 10:69045930-69045952 TTGCTTCCAGCTTGAGGTAATGG + Intergenic
1069687186 10:70325692-70325714 GTCAGTCCAGCATCTGGTAAGGG + Intronic
1070816622 10:79328513-79328535 CTGTCTCCAGCTCCTGGTAATGG - Intergenic
1071343729 10:84671700-84671722 TAGATTCCATCTTCTGCTGATGG - Intergenic
1075178262 10:120185759-120185781 TTGGTTCCAGTTTCAGGTATAGG + Intergenic
1078358254 11:10648737-10648759 TTGATTGCAGCTTCTGATTAAGG + Intronic
1079386662 11:19986168-19986190 TTGTTTCCTGCTTCTGGAGATGG + Intronic
1080557118 11:33428033-33428055 TTGTTTCCACCTTTTGGTTATGG + Intergenic
1081161307 11:39752977-39752999 TTTATTCCAGTTTCTGATACAGG + Intergenic
1081445085 11:43123448-43123470 TTGGTTCCAGCTACTGCCAAAGG + Intergenic
1082941477 11:58709787-58709809 CTGGTTCCAGCTTCTGGGAATGG + Exonic
1083906152 11:65672289-65672311 TTCTCTCCAGCTTCTTGTAATGG - Intergenic
1086385013 11:86298218-86298240 ATATGTCCAGCTTCTGGTAAGGG + Intergenic
1087221398 11:95550337-95550359 TTGATTTCAGTTAGTGGTAAGGG - Intergenic
1087743298 11:101914438-101914460 TTGCTGCCAGATTCTGGAAATGG - Intronic
1088160357 11:106862696-106862718 CTCATTCCAGTTTCTGGTCAGGG - Intronic
1089831646 11:121334152-121334174 TTTATTCTAGCTTAAGGTAAAGG - Intergenic
1093540083 12:20271982-20272004 TTGATTACAGCATCTCCTAAAGG + Intergenic
1095130832 12:38540535-38540557 TTGATTCCAGCTTCAGCAGAAGG - Intergenic
1099955050 12:89345421-89345443 ATAATTCCAGCTTCTGTTCATGG - Intergenic
1101486493 12:105168166-105168188 TTGATTCCAGCTTTTAGAATGGG + Exonic
1104180841 12:126378970-126378992 TAGATTCCAGCTGATGGAAATGG + Intergenic
1106649401 13:31673591-31673613 CTGATTGCTGCTTCTGGTCATGG - Intergenic
1106674559 13:31944735-31944757 TTGATTCCAGGCACTGGGAAGGG + Intergenic
1106678666 13:31987601-31987623 CTGAGGCCAGCTTCAGGTAAAGG + Intergenic
1110673109 13:78205806-78205828 GTAATTCCAGCTACTGGGAAGGG - Intergenic
1113032604 13:106010876-106010898 TTCTATCCAGCTTCTGGTGATGG - Intergenic
1114480847 14:23033525-23033547 CGGATTGCAGCTTCTGGGAACGG - Exonic
1115974588 14:38982322-38982344 TTGGTTTCTGCTTCTGGTAATGG - Intergenic
1117460899 14:55943644-55943666 TTGAGTTCAGCTTATGGTGATGG + Intergenic
1120731057 14:88002127-88002149 GTGGTCCCAGCTTCTGGCAAGGG + Intergenic
1124568090 15:30834476-30834498 ATCATGCCAGCTGCTGGTAAGGG + Intergenic
1126743576 15:51802264-51802286 TTGATTCCAGATTATATTAATGG + Intronic
1126930669 15:53646647-53646669 GTGTCTCCAGCTTCTGGAAAGGG + Intronic
1127148741 15:56051864-56051886 GTGATTCCAGCATCTGAGAATGG + Intergenic
1128599481 15:68983749-68983771 CTGTCTCCAGGTTCTGGTAAAGG - Intronic
1130361291 15:83188973-83188995 TGAATTCCAGGTTCTGGTAAGGG - Intronic
1131174255 15:90200504-90200526 TTGATTTCAGAATCTGCTAATGG + Intronic
1134168442 16:11949019-11949041 GTAATCCCAGCTTCTTGTAAGGG + Intronic
1138648707 16:58444563-58444585 GTGATGGCAGCTTCTGGTGAGGG - Intergenic
1139501499 16:67370057-67370079 TGGATTCCATTTTCTTGTAACGG - Intronic
1141596583 16:85100633-85100655 TTGATTCCAGCTCCTGATGGGGG - Intronic
1141706598 16:85668567-85668589 TTTCTTCCGGCTTCTGGTAGCGG + Intronic
1141729953 16:85815482-85815504 TTGTTTCCACCTTCTGGTTATGG + Intergenic
1144373513 17:14616158-14616180 TTGCTTCCAGCTTTAGGCAATGG + Intergenic
1146935937 17:36812829-36812851 TGGATTCCAGCTTCTGGGACTGG - Intergenic
1150179285 17:63098623-63098645 TTGACTTCCACTTCTGGTAATGG - Intronic
1150429981 17:65107283-65107305 ATGGTGACAGCTTCTGGTAAGGG + Intergenic
1150668412 17:67167949-67167971 TTGTTTCCAGCTTGTATTAAAGG - Intronic
1152440185 17:80303465-80303487 TGGATCCCAACTTCTGCTAAAGG + Intronic
1153314483 18:3708475-3708497 AGGATTCCAGCTTCTTGTCAAGG + Intronic
1156314052 18:35950867-35950889 GAGGTTCCAGCTTTTGGTAACGG + Intergenic
1156630755 18:38965418-38965440 TTGATTCCATCTTCTATTGAAGG + Intergenic
1157339263 18:46764821-46764843 TTGATCCCAGCTCCTGGGGATGG - Intergenic
1158891835 18:61879607-61879629 TTTATTCCACTTTCTGGTATGGG + Intronic
1159457911 18:68685945-68685967 TTGATACCAGTTTCTTGAAAAGG - Intronic
1159523470 18:69557322-69557344 TTAAATCCAACTTCTGGTTAAGG + Intronic
1160287619 18:77559608-77559630 GTTCTTCCAGCTTCTGGTGATGG + Intergenic
1161875626 19:6906777-6906799 TGCATTCCAGCTTGTGGGAAGGG + Intronic
1163059133 19:14745569-14745591 TAGATTCCAGAGTCTGGAAAGGG - Intronic
928083178 2:28327732-28327754 TTGATTCCAGCTGAGGGCAAGGG + Intronic
930236621 2:48894966-48894988 TTCATTCCAGATTCTGGAAAGGG + Intergenic
931937815 2:67217596-67217618 ATGACACCAGCTTCTGGGAAGGG - Intergenic
932206261 2:69885611-69885633 ATGCTTCCAGCATCTGGTGAGGG - Intergenic
932800829 2:74741114-74741136 CTAATTCCAGCTTCTCTTAAAGG - Intergenic
933989902 2:87626707-87626729 TTGGTTCCAGGGTCTGGCAAGGG + Intergenic
934711950 2:96522138-96522160 ATGGTGCCAGCATCTGGTAAGGG - Intergenic
935791362 2:106593205-106593227 AATAATCCAGCTTCTGGTAATGG - Intergenic
936303943 2:111324117-111324139 TTGGTTCCAGGGTCTGGCAAGGG - Intergenic
937726369 2:125172338-125172360 TAGATTCCAGCTTCTTATACTGG + Intergenic
938714917 2:134010353-134010375 GTGATTCCAGCTTGTGGCCAAGG - Intergenic
939120537 2:138110892-138110914 GTGATTCCAGTATGTGGTAAAGG + Intergenic
940515332 2:154677263-154677285 ATGATGCCAGCATCTGGTGAGGG - Intergenic
941708340 2:168684074-168684096 TTGATTGCAGAATGTGGTAAAGG + Intronic
942970246 2:181949813-181949835 ATAAGTCCATCTTCTGGTAAGGG - Intergenic
944841010 2:203623720-203623742 TTTATTCCAGCTCAGGGTAAAGG - Intergenic
945460811 2:210106258-210106280 TTGATTCCAGTTTATAGTATGGG + Intronic
946185748 2:217979570-217979592 TTGATTCCAGCTTCTGGTAATGG - Intronic
946380536 2:219345723-219345745 TTGATTTCTGCTCCTGGCAATGG - Intergenic
947105936 2:226667950-226667972 TAAATTCCAGCTCCAGGTAATGG + Intergenic
948672279 2:239576184-239576206 TTGATCCCAGCTGCTGGCCAAGG + Intergenic
1168969285 20:1919705-1919727 ATGCTTCCAGCTTCTGTAAATGG + Intronic
1169171149 20:3466759-3466781 TTGATTCCACTTTGAGGTAAGGG - Intergenic
1170405289 20:16029323-16029345 TTGAAACCAGCTGCTGGCAAAGG + Intronic
1170716520 20:18836288-18836310 GTGATTCCTGATTCTGTTAATGG + Intergenic
1179354373 21:40645012-40645034 TTTATTCCAGCTTCAGGTTTTGG + Intronic
1180054405 21:45349799-45349821 TTGCTTCCAGCCTTTGGGAACGG + Intergenic
1180193190 21:46178764-46178786 TTAATTCCAGCTACTGGGGAGGG + Intronic
1181054021 22:20251254-20251276 AGGATTCCAGCCTCTGCTAAAGG + Intronic
952314602 3:32221732-32221754 TTAAGTCCAGCTTCTGGTGGTGG - Intergenic
953088049 3:39692840-39692862 TTTGTTCCTGCTTCTGGTAATGG - Intergenic
953368444 3:42366929-42366951 TTGTTTCTAGTTTCTGGTACAGG + Intergenic
957029050 3:75218868-75218890 GTAATTCCAGCATATGGTAAAGG + Intergenic
957345349 3:78953603-78953625 TTGATTCCAGTTTCTTCTACTGG - Intronic
957493661 3:80963025-80963047 TTGCTTCTAGTTTCTGCTAAGGG + Intergenic
957826960 3:85459573-85459595 TTTATTTCAGCATCTGGTTAGGG - Intronic
958920917 3:100104285-100104307 TTGATTCCAGTTTCAGGCAGAGG - Intronic
959803251 3:110521091-110521113 TGGATTGCAGTTTCTGGGAAAGG + Intergenic
962282478 3:134062469-134062491 ATGATGCCAGCATCTGGTGAGGG + Intergenic
963172990 3:142270231-142270253 TTGCTTCCACCTTCTGGCTATGG - Intergenic
963887375 3:150597569-150597591 TCTATTCCTTCTTCTGGTAATGG - Intronic
964507455 3:157415121-157415143 TGGATAACAGCTGCTGGTAAGGG - Intronic
964515896 3:157507247-157507269 TTGATTTCATCCTCAGGTAATGG - Intronic
965312002 3:167139994-167140016 TTCCTTCTAGCTTCTGGTGATGG - Intergenic
965872197 3:173276767-173276789 TTGAATCCAGCGTCAGGTGAAGG - Intergenic
968839959 4:2996091-2996113 TTAATGCCAGCATCTGGCAAGGG + Intronic
969284244 4:6192734-6192756 TTGATTCTAGCTTCTGGGGAGGG + Intronic
973032967 4:45367011-45367033 ATGAGTTCAGCTTCTGGTGAGGG - Intergenic
973669953 4:53206982-53207004 ATGGTTCCAGCATCTGGTGAGGG + Intronic
974828514 4:67160287-67160309 AAGATTCCAGCTTCAGGTCAGGG - Intergenic
978776074 4:112508218-112508240 TTGAATCCACCTTCTTGTATTGG + Intergenic
979172886 4:117624131-117624153 TTGATTGCAGATTCAGGAAATGG + Intergenic
979535838 4:121819651-121819673 TTCATTCCATATTCTGCTAATGG - Intronic
979580489 4:122352984-122353006 TGCATTCCATCTTCTGGTAATGG - Exonic
980481417 4:133392970-133392992 TTGAATCAATCTACTGGTAATGG - Intergenic
980850131 4:138371352-138371374 ATGATTTCAGGTTCTGGAAAAGG - Intergenic
987329370 5:16842379-16842401 TTGATTGCAGCATCTTCTAAAGG - Intronic
988347358 5:30055769-30055791 TTTTTGCCAGCCTCTGGTAATGG - Intergenic
988780995 5:34521791-34521813 GTGACTCCCGCTTCTGGTAGAGG - Intergenic
990373627 5:55146746-55146768 TTGCTGCCACCTTGTGGTAATGG + Exonic
992098689 5:73384914-73384936 TTGATTCCTGATTTTGGTAAAGG - Intergenic
992952600 5:81875241-81875263 TTCCTTCCAGCTTCTTCTAAGGG - Intergenic
994200610 5:96971262-96971284 TTGTTTCCAGGTTCTCTTAAAGG + Intronic
996007102 5:118434611-118434633 TTTCTTCCATCTTCTGATAAAGG + Intergenic
996384310 5:122894702-122894724 GTGCTTACTGCTTCTGGTAAGGG + Intronic
998326584 5:141286361-141286383 TTGAGTCCTGCTTTTGGTAAGGG + Intergenic
998543858 5:143009005-143009027 TTCATTGCAGCTTCTGGGTAAGG + Intronic
999116865 5:149172161-149172183 TTGATTTCAGGATCTGGCAATGG - Intronic
999755070 5:154658201-154658223 GTAATCCCAGCTACTGGTAAGGG - Intergenic
1000793274 5:165632897-165632919 TTGAGTTCAGCTTCTGATATAGG - Intergenic
1001839950 5:174866952-174866974 CTGATTGCAGCTTCTGATCACGG - Intergenic
1006842627 6:37039565-37039587 TAGATTCCACCTTGTGGTAGTGG - Intergenic
1007129070 6:39452630-39452652 TTGATCACAGCATTTGGTAAGGG - Intronic
1008181933 6:48341910-48341932 TTTATTTCTGCTTCTGGTCAAGG - Intergenic
1011406003 6:87015967-87015989 TTGATCCCCTTTTCTGGTAAAGG - Exonic
1011864141 6:91801110-91801132 TTGTTTCCATCTTATGGAAAAGG + Intergenic
1012007736 6:93735510-93735532 TTTATTCTAGATTCTGGTTAAGG - Intergenic
1013729055 6:113141383-113141405 TTCATCCCAGCTCCTGGTGAGGG + Intergenic
1014492924 6:122084214-122084236 CTGATTGCTGCTTCTGATAATGG + Intergenic
1014524233 6:122482278-122482300 TTTATTCCAGCTTGTGCTCAAGG + Intronic
1017310526 6:152970863-152970885 TTGATTCAATTTTATGGTAAAGG - Exonic
1017650194 6:156573894-156573916 TAGATTCCAGAGTCTGGGAAGGG - Intergenic
1017805800 6:157944583-157944605 TTTATTCCAGCTGCTGAAAATGG + Exonic
1018651269 6:165993026-165993048 TTGTTGCCAGCCTCTGGTGAGGG - Intergenic
1021739418 7:23670956-23670978 TTTATTCCAAGCTCTGGTAAAGG + Intergenic
1022026104 7:26449287-26449309 ATGATTCCAGCTCCTAGTCATGG + Intergenic
1023735639 7:43233930-43233952 TAGATTGCAGCTTCTGGTACGGG + Intronic
1023903011 7:44498736-44498758 TTGATGCCAGCATCTGTTGAGGG + Intergenic
1024319332 7:48049301-48049323 TTGATTTCACATTCTGGAAAAGG - Intronic
1026102558 7:67395097-67395119 TTGATGCCAGCATCTGGTTCTGG + Intergenic
1026155462 7:67822041-67822063 ATGAGTCCAGCTTTTGGCAAAGG + Intergenic
1026311968 7:69194117-69194139 TTGTTTCCACCTTTTGGTAATGG - Intergenic
1027495142 7:78878824-78878846 GTGATTCCAGCTTTTGGTCCAGG - Intronic
1030005098 7:105110384-105110406 CTGATTCCACTTTCTGGTGAAGG - Intronic
1031342084 7:120615280-120615302 TTGAAGCCAGGTTCTGGTAGAGG - Intronic
1032514541 7:132496850-132496872 TTGCTTCCAGTTTCTGGAGATGG - Intronic
1036164763 8:6422402-6422424 TTACTTCAAGCTTCTAGTAAAGG - Intronic
1036781653 8:11651860-11651882 TTGGTTCCAGATCCTGGGAAGGG + Intergenic
1037500323 8:19479214-19479236 ATGATTCCAGCTTCATATAAGGG - Intronic
1037726006 8:21483088-21483110 TAGATACCAGCATCTGGGAAGGG - Intergenic
1038085758 8:24194633-24194655 CTGACTGGAGCTTCTGGTAAAGG + Intergenic
1041714139 8:60918453-60918475 TTAATTCCCTCTGCTGGTAAAGG - Intergenic
1042421677 8:68597785-68597807 TTTATTCCTGCTTCTTGTCATGG + Intronic
1044146353 8:88719435-88719457 TTGATTCTGGCTTCTGCTACTGG + Intergenic
1044994101 8:97822376-97822398 TAGCTTCGAGTTTCTGGTAATGG - Intronic
1051158793 9:14182480-14182502 TTAATTCCAACTGCTGGAAAAGG + Intronic
1052430381 9:28358906-28358928 TTGAATCCAACTGCTGCTAAGGG + Intronic
1055365484 9:75539924-75539946 TGAATTCCAGCTTCTGTTATGGG - Intergenic
1055368998 9:75576531-75576553 ATTCTTTCAGCTTCTGGTAATGG - Intergenic
1056083811 9:83124903-83124925 TTGGTTCCAGGTTTTGCTAATGG - Intergenic
1056663660 9:88563170-88563192 TTGATTCCTGTTTGTGGTAATGG + Intronic
1059534916 9:115071604-115071626 ATCATTCCACCTTCTGGTGATGG - Intronic
1059656605 9:116363264-116363286 TTGATTCCCTCATCTGTTAAAGG - Intronic
1060236078 9:121863598-121863620 TTGATTGCAGCATCTGCTACTGG + Intronic
1060905405 9:127300441-127300463 TTAATTCCAGCTTCTTGTTTGGG + Intronic
1061640298 9:131948935-131948957 TTGATTTCGACTTCTGGAAATGG - Intronic
1186293102 X:8121369-8121391 TTGTTTCCAAATTCAGGTAAGGG + Intergenic
1189001041 X:36947198-36947220 TTTATGCCATCTTCTGGCAATGG + Intergenic
1189576464 X:42359042-42359064 TTGATTCCACATTGTGATAATGG - Intergenic
1190140026 X:47834863-47834885 TTGGTGCCAGCATCTGGTGAGGG - Intergenic
1194171090 X:90583254-90583276 TTTATTAAAGCTTCTGGTTATGG + Intergenic
1194361575 X:92958316-92958338 TAGATTCCATCTTTTGATAAAGG - Intergenic
1196599558 X:117585799-117585821 TTGACCCCAGGTTCTGGTAAAGG + Intergenic
1197857030 X:130925143-130925165 TTTATTCCATCTACTGTTAATGG + Intergenic
1199417324 X:147600098-147600120 CTGAATCCAGCATCTGGGAAAGG - Intergenic
1200517321 Y:4160998-4161020 TTTATTAAAGCTTCTGGTTATGG + Intergenic
1200669768 Y:6074190-6074212 TAGATTCCATCTTTTGATAAAGG - Intergenic