ID: 946185749

View in Genome Browser
Species Human (GRCh38)
Location 2:217979576-217979598
Sequence GGAAATTTGATTCCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185749_946185752 -2 Left 946185749 2:217979576-217979598 CCAGAAGCTGGAATCAAATTTCC 0: 1
1: 0
2: 0
3: 7
4: 170
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185749 Original CRISPR GGAAATTTGATTCCAGCTTC TGG (reversed) Intronic