ID: 946185749

View in Genome Browser
Species Human (GRCh38)
Location 2:217979576-217979598
Sequence GGAAATTTGATTCCAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185749_946185752 -2 Left 946185749 2:217979576-217979598 CCAGAAGCTGGAATCAAATTTCC 0: 1
1: 0
2: 0
3: 7
4: 170
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185749 Original CRISPR GGAAATTTGATTCCAGCTTC TGG (reversed) Intronic
900770142 1:4534659-4534681 GGAAATTAAGTTCCAGCTCCTGG - Intergenic
902182250 1:14698209-14698231 GCAGCTTTGATTTCAGCTTCAGG + Intronic
906537090 1:46557032-46557054 AGAAATTTGTTTCCTGCTTGTGG + Intergenic
906694763 1:47816498-47816520 TGCAATTTGTTTCCTGCTTCAGG + Intronic
906803773 1:48760073-48760095 GGAAGTTAGATTCCAAATTCTGG - Intronic
910921422 1:92351786-92351808 GGAAACCTGATTCCCACTTCTGG - Intronic
912428336 1:109613867-109613889 GGAAATTGGACTCCAGACTCTGG + Exonic
913323994 1:117610429-117610451 CAAACTTTGAATCCAGCTTCAGG + Intronic
913430471 1:118785608-118785630 TGACATTTAATTCCAGCTTGGGG + Intergenic
921417852 1:214911321-214911343 GGAAATATGATGCAAGATTCAGG + Intergenic
921921525 1:220675554-220675576 GGAAAATTATTGCCAGCTTCAGG - Intergenic
1062944135 10:1447583-1447605 TAAAATGTGATTGCAGCTTCAGG + Intronic
1063101553 10:2954414-2954436 GCAAATTTTATTCAAGCTTAAGG + Intergenic
1063137783 10:3231970-3231992 GGAAATTTGATACCAAATCCAGG - Intergenic
1063137786 10:3231991-3232013 GGAAATTTGATACCAAATCCAGG - Intergenic
1064238869 10:13606412-13606434 CAAAATTTGTTTCCAGCTTTGGG + Intronic
1064915329 10:20450110-20450132 GCAAATGTGTGTCCAGCTTCTGG - Intergenic
1065396329 10:25242273-25242295 TGAAATTTTATTTCAGCATCTGG - Intronic
1067535848 10:47109325-47109347 GCAAATTTAAGTCCAGCTCCAGG + Intergenic
1069096480 10:64265592-64265614 GAAAATTATATTCCAGCTCCTGG - Intergenic
1069511470 10:69045924-69045946 GGAACCTTGCTTCCAGCTTGAGG + Intergenic
1069778378 10:70939956-70939978 GGAAAAGGGATTCCAGTTTCAGG + Intergenic
1070361911 10:75698691-75698713 GTAAATTTTATTACAGTTTCTGG + Intronic
1072030518 10:91517184-91517206 GGAAATTTGATTCCAGAGGTAGG - Intergenic
1073859879 10:107725800-107725822 GGAAATTTAATTCCATCATTAGG + Intergenic
1076499119 10:130921875-130921897 AGAATTTTGATTCAGGCTTCAGG + Intergenic
1081812335 11:45921157-45921179 GGAAATGTGATTCCCTCTCCAGG - Intergenic
1084223188 11:67697423-67697445 GGAAATGTGGGGCCAGCTTCTGG - Intergenic
1084661876 11:70550832-70550854 GGAAATGTGAGTCCAGCCTCAGG + Intronic
1087478756 11:98672197-98672219 TGCAATTTGATTACATCTTCAGG - Intergenic
1087777594 11:102270510-102270532 GGAAATTTCCTTCCAGCTCTAGG + Intergenic
1088062318 11:105670143-105670165 GGAAATTTCCTTCTAGATTCTGG + Intronic
1088577036 11:111282482-111282504 GGAATTTTGATTTCTTCTTCTGG + Intronic
1090183340 11:124719557-124719579 GGAATTCTGATTCCTGTTTCAGG + Intergenic
1092929992 12:13306816-13306838 TGAAATGTGATTGGAGCTTCAGG - Intergenic
1095791333 12:46170605-46170627 GGAACTGTCATACCAGCTTCAGG - Intergenic
1095930394 12:47619827-47619849 GGAAACCAGATTCCAGCATCAGG + Intergenic
1099692728 12:85980130-85980152 CGAAATTTGACTCTATCTTCTGG + Exonic
1100381129 12:94062938-94062960 AGAAATCAGATTCCAGCTGCTGG - Intergenic
1101432623 12:104639343-104639365 GGACATTTGTTTCCAGTTTGGGG - Intronic
1103352918 12:120297915-120297937 GAAAATTTCAGTCTAGCTTCTGG + Intergenic
1104385919 12:128351563-128351585 GGAAATATGGTGCCAGCATCTGG + Intronic
1104530803 12:129569292-129569314 TTCAATTTGATTCCAGCTACTGG - Intronic
1106842434 13:33698531-33698553 GGATATTTGTTTCCAGTTTTGGG + Intergenic
1107756587 13:43629987-43630009 GGAATTTTTATTCCAGTTCCTGG + Intronic
1111141335 13:84123309-84123331 GGAAATTTGATTCCAACAGTAGG + Intergenic
1111930352 13:94506295-94506317 GGAAAGTTGATTCCAGGGTTGGG + Intergenic
1115061440 14:29195327-29195349 GGAAGTTTGGTTCCAGTTTTCGG + Intergenic
1115712276 14:36063496-36063518 GGACATTTGTTTCCAGTTTGAGG + Intergenic
1116715161 14:48417502-48417524 GGAAGTGTGGTGCCAGCTTCTGG - Intergenic
1116779159 14:49216927-49216949 GGAATTTTGACTCCATCTTTTGG - Intergenic
1117054436 14:51897491-51897513 GGAAATTTGGTTCCATCTGTGGG - Intronic
1117321390 14:54627138-54627160 GAAAATTTAATTCCAGAGTCTGG - Intronic
1117753611 14:58949905-58949927 GGATATTTGGTTCCAGTTTGAGG + Intergenic
1119592079 14:75899397-75899419 GGAAAATATATTCCAACTTCTGG - Intronic
1120768979 14:88358189-88358211 GGAAATGTGATTCCACTCTCTGG + Intergenic
1120965051 14:90159488-90159510 GGAAATGCTATTCCAGCTGCAGG + Intronic
1121925090 14:97920158-97920180 GGGAGTTTGGTTCCAGCTTAGGG - Intergenic
1123139344 14:106060204-106060226 GGAAACTTCATTCCATCTTGGGG + Intergenic
1123916213 15:25030650-25030672 GGTATTTTGAGTCCATCTTCAGG + Intergenic
1130916433 15:88308768-88308790 GGAAATTTGGTTCCGGCCCCTGG - Intergenic
1131367950 15:91855075-91855097 TGACATTTGATTCCAGTTGCGGG - Intronic
1131986168 15:98044428-98044450 GGAACCTTGATTCAAGATTCAGG - Intergenic
1132233829 15:100204436-100204458 GGATATTGGATTGCAGATTCAGG + Intronic
1133814624 16:9187198-9187220 GGGAGTTTGAATCAAGCTTCTGG + Intergenic
1134361054 16:13531567-13531589 AGAAATTTGATTTGACCTTCTGG + Intergenic
1134740274 16:16536833-16536855 AGAAATTTGAGTCCAAGTTCGGG - Intergenic
1134927226 16:18175334-18175356 AGAAATTTGAGTCCAAGTTCGGG + Intergenic
1135573013 16:23563719-23563741 TAAATTTTGGTTCCAGCTTCTGG + Intronic
1138002065 16:53291149-53291171 GGAATTATGATTCTAACTTCAGG + Intronic
1144183165 17:12771497-12771519 AGAAAGATGATTCCAGCTACAGG + Intergenic
1145864403 17:28231256-28231278 GGAAAATGGTTTCCAGCTACAGG - Intergenic
1146524995 17:33559356-33559378 CAAAATCTGATTCCTGCTTCTGG + Intronic
1147446115 17:40476199-40476221 GGAGAAATGGTTCCAGCTTCTGG + Exonic
1152619965 17:81358243-81358265 GGAAACTGGATCCCAGGTTCTGG + Intergenic
1152936132 17:83137921-83137943 GGGATTTTGCTTCCACCTTCAGG + Intergenic
1156254604 18:35383217-35383239 AGAAATTTGAGACCAGCTTGGGG + Intergenic
1156702932 18:39846056-39846078 GCAAATTGGAGCCCAGCTTCTGG - Intergenic
1159241330 18:65747388-65747410 TTAAATATGATTCCATCTTCTGG - Intergenic
1166685433 19:44793635-44793657 GGAATTTGGATTCCAGCTCCCGG - Intronic
928848680 2:35714031-35714053 GAATATTTTGTTCCAGCTTCTGG + Intergenic
930236619 2:48894960-48894982 GGAATTTTCATTCCAGATTCTGG + Intergenic
930475247 2:51873820-51873842 GGAATTCTGGTTCCAGCTTCTGG + Intergenic
930898545 2:56475012-56475034 GGAAGTGTGATTTCAGGTTCTGG + Intergenic
931910972 2:66899530-66899552 GGAAATTTGATTTCCCTTTCTGG - Intergenic
932670265 2:73731436-73731458 GTAAATTTTATTCCAGGTACTGG + Intronic
933309801 2:80646399-80646421 GCAAATATCATTCCAGCCTCAGG - Intronic
939519413 2:143210711-143210733 TGAAATTTGATTTCAGATTTAGG - Intronic
939832200 2:147086389-147086411 TGAAATTTGTTTCAAACTTCTGG + Intergenic
940027012 2:149219176-149219198 GGAAAATTGGTTCCAGCTAAGGG + Intergenic
940698270 2:157008459-157008481 GGAAACTTGGAGCCAGCTTCTGG - Intergenic
942937179 2:181571870-181571892 GGAAATTTTAATTCATCTTCAGG + Intronic
943414503 2:187584029-187584051 GGAGAATTCATCCCAGCTTCTGG - Intergenic
943701150 2:190989318-190989340 GGAATGTTGATACCAGCTCCAGG + Intronic
946185749 2:217979576-217979598 GGAAATTTGATTCCAGCTTCTGG - Intronic
947568843 2:231214932-231214954 GGAGATAGAATTCCAGCTTCTGG - Exonic
948765944 2:240218946-240218968 GGAAGGTGGATTTCAGCTTCTGG + Intergenic
1174101297 20:48128121-48128143 GGAACTTTGGCTCCAGCTGCAGG - Intergenic
1174156371 20:48518164-48518186 GGAACTTTGACTCCAGCTGCAGG - Intergenic
1174221978 20:48963364-48963386 GGAAATCTCATGCCAGATTCTGG + Intronic
1176357792 21:5966914-5966936 GCAGAATTGATTCCATCTTCAGG + Intergenic
1177620230 21:23581438-23581460 GGACATTGGATTCCATCTTTGGG - Intergenic
1179765726 21:43571637-43571659 GCAGAATTGATTCCATCTTCAGG - Intronic
1181459953 22:23079966-23079988 GGGAATCTGATTTCACCTTCTGG - Intronic
1183169685 22:36178138-36178160 GTAAATTTCATGCCAGCTACCGG + Intergenic
1183540062 22:38424662-38424684 GGAAATTAGTTTCCACCTTTTGG - Intergenic
1185156886 22:49198440-49198462 GGCTATTTGATTCCACCTCCTGG - Intergenic
951737638 3:25885351-25885373 GGAAATTTGATTTCATCCTCAGG + Intergenic
952970141 3:38645541-38645563 GGAAATGTGATTCCTGCTGGGGG - Intronic
954579577 3:51695984-51696006 GGAACTCTGAATCCAGTTTCTGG + Intronic
956531099 3:70220093-70220115 AAAAATTTGAGGCCAGCTTCAGG - Intergenic
958746081 3:98136597-98136619 TAAAATTTGATTCCAAATTCTGG + Intergenic
958748988 3:98172636-98172658 TGAAATTTGATTCCAAATACTGG + Intronic
962810309 3:138953933-138953955 GGACATTTGTTTCCAGTTTTTGG + Intergenic
963202523 3:142599662-142599684 GGAAATTTGAACAGAGCTTCTGG - Intronic
966838436 3:184067954-184067976 GGGCATTTATTTCCAGCTTCTGG - Intergenic
967813999 3:193783683-193783705 GGAACAATGTTTCCAGCTTCTGG + Intergenic
972151651 4:36098730-36098752 ACAAATTTGATTCCTACTTCTGG + Intronic
972403550 4:38726538-38726560 GGAAAATTGCTTCTAGATTCTGG - Intergenic
974170866 4:58265650-58265672 GGTGATTTATTTCCAGCTTCGGG - Intergenic
974841458 4:67304047-67304069 GGAATTCTCATTACAGCTTCTGG - Intergenic
979157603 4:117417112-117417134 GGAAGTTTGATTACAGCCCCAGG + Intergenic
984929688 4:184835617-184835639 GGAAGTTTCATTCCAAGTTCAGG + Intergenic
987167890 5:15220033-15220055 AAAAATTTGCTTCCAGCTGCAGG + Intergenic
988155269 5:27441738-27441760 GGAACTTCAATTCCAGCTGCTGG - Intergenic
988695263 5:33615580-33615602 GGAGGTTTGAGTTCAGCTTCTGG - Intronic
988898366 5:35702703-35702725 GGCAATGTGACTCCAGGTTCTGG - Intronic
989810743 5:45670379-45670401 AGAATTTTAATTCCAACTTCTGG + Intronic
990707876 5:58550053-58550075 TGAAAATTGATTCCAGGTTAAGG + Intronic
993752326 5:91686205-91686227 TGAAATTTGAGTCCTGCTACTGG - Intergenic
994199431 5:96955704-96955726 GGACATTTGTTTTCAGCTTGGGG + Intronic
995340020 5:111048085-111048107 GAACTTTTGATTCTAGCTTCTGG + Intergenic
996094909 5:119388431-119388453 GGGAAATTGATTGCTGCTTCTGG + Intronic
996238407 5:121164166-121164188 GGAAATTATATTCCAGTTACTGG - Intergenic
996493852 5:124130485-124130507 GCCAGTTTGATTCCAGCTCCAGG - Intergenic
996510401 5:124309583-124309605 GGAAATTTGAATTCAGTCTCTGG + Intergenic
997347955 5:133206685-133206707 GGGAATTTTATTCCAGATACAGG - Intronic
998814435 5:145998465-145998487 GGATATTTTATTCCAGCTCTAGG - Intronic
1000079612 5:157832437-157832459 GGATATTTGATACCATCTTTGGG + Intronic
1000279239 5:159767936-159767958 GGAAAAATGATTTCAGATTCGGG - Intergenic
1001418013 5:171562040-171562062 GGACATTTGTTTCCAGTTTTTGG + Intergenic
1001872317 5:175167551-175167573 ACAAATGTGCTTCCAGCTTCTGG - Intergenic
1002005418 5:176229294-176229316 GGAAATTTGAACACAGCGTCAGG - Intergenic
1003038622 6:2666978-2667000 GGAAATAACATTCAAGCTTCTGG - Exonic
1007737450 6:43990517-43990539 GGAAATGTGAATCCAGTCTCCGG + Intergenic
1008336207 6:50307777-50307799 AGAATTTTTATTTCAGCTTCAGG + Intergenic
1010488118 6:76440098-76440120 GGAATTTTGCTTCCTGCTTATGG + Intergenic
1012111006 6:95233874-95233896 GGAAAATTGATTCCCGGTCCAGG + Intergenic
1012257850 6:97054958-97054980 TAAAAATTGATTCCAGCTTGTGG + Intronic
1013700963 6:112768850-112768872 TAAAAGTTGCTTCCAGCTTCTGG - Intergenic
1018545964 6:164935956-164935978 GGAGAGTTGATGCCAGTTTCTGG + Intergenic
1020351368 7:7222652-7222674 GGAAATTTGATTACAGACTGTGG + Intronic
1020954502 7:14723925-14723947 ATAATTTTAATTCCAGCTTCAGG + Intronic
1021447728 7:20751205-20751227 GAAAATTTGAATCCATTTTCTGG - Intronic
1024902615 7:54338041-54338063 GGAAATTTGATTCTGGCCTTTGG - Intergenic
1026739728 7:72971334-72971356 AGAAATTTTATTCAAACTTCTGG - Intergenic
1027104004 7:75393736-75393758 AGAAATTTTATTCAAACTTCCGG + Intergenic
1028226921 7:88263051-88263073 AGAATTCTGATTCCAGATTCGGG - Intergenic
1028375677 7:90144397-90144419 GGACATTTGTTTCCAACTTTGGG - Intergenic
1030192967 7:106827850-106827872 TGAAAGTTGATTCCAGCTGAAGG + Intergenic
1030854348 7:114534194-114534216 TCAAATTTAATTACAGCTTCCGG + Intronic
1034313707 7:150111264-150111286 GGAAGCTGGAGTCCAGCTTCTGG + Intergenic
1035699208 8:1625908-1625930 GGAAATGTGATGCTAGCCTCTGG + Intronic
1038418152 8:27412656-27412678 GGAAGATAGATTTCAGCTTCAGG - Intronic
1039192450 8:34992167-34992189 AGAAATTTGATCACATCTTCAGG - Intergenic
1040351622 8:46574761-46574783 GGATATTGGATCCCAGGTTCAGG - Intergenic
1040365052 8:46706661-46706683 GGATATTGGATCCCAGGTTCAGG + Intergenic
1042185644 8:66134215-66134237 GGAAATTTGAAGAAAGCTTCTGG + Intronic
1043150744 8:76712821-76712843 TGAAATTTAATTCCAGTTGCAGG + Intronic
1044049237 8:87479354-87479376 GGAAATATGAATGCAGTTTCTGG + Intronic
1044759041 8:95497480-95497502 GAAAATTTTTTTCCAGGTTCAGG + Intergenic
1045793403 8:106013465-106013487 AGAAATTTAATTCCTGCATCTGG + Intergenic
1046686521 8:117233735-117233757 GGAAATTTGCTCCCAACTCCAGG + Intergenic
1047773327 8:128048578-128048600 GGGAAGCTGATCCCAGCTTCTGG - Intergenic
1048737908 8:137521996-137522018 GGTAATTTGATTACAGCTAAGGG - Intergenic
1052436189 9:28432602-28432624 GTTAATTTGATTGCAGCTTCAGG + Intronic
1188830590 X:34891875-34891897 GGTACATTGATTACAGCTTCTGG + Intergenic
1193729711 X:85088353-85088375 GGATATTTTATTCCAGCTCTAGG - Intronic