ID: 946185750 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:217979583-217979605 |
Sequence | CTGGAATCAAATTTCCTATA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 486 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 20, 4: 465} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946185747_946185750 | -9 | Left | 946185747 | 2:217979569-217979591 | CCCATTACCAGAAGCTGGAATCA | 0: 1 1: 0 2: 1 3: 14 4: 149 |
||
Right | 946185750 | 2:217979583-217979605 | CTGGAATCAAATTTCCTATAAGG | 0: 1 1: 0 2: 0 3: 20 4: 465 |
||||
946185746_946185750 | -6 | Left | 946185746 | 2:217979566-217979588 | CCTCCCATTACCAGAAGCTGGAA | 0: 1 1: 0 2: 3 3: 30 4: 261 |
||
Right | 946185750 | 2:217979583-217979605 | CTGGAATCAAATTTCCTATAAGG | 0: 1 1: 0 2: 0 3: 20 4: 465 |
||||
946185748_946185750 | -10 | Left | 946185748 | 2:217979570-217979592 | CCATTACCAGAAGCTGGAATCAA | 0: 1 1: 0 2: 0 3: 18 4: 190 |
||
Right | 946185750 | 2:217979583-217979605 | CTGGAATCAAATTTCCTATAAGG | 0: 1 1: 0 2: 0 3: 20 4: 465 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946185750 | Original CRISPR | CTGGAATCAAATTTCCTATA AGG | Intronic | ||