ID: 946185752

View in Genome Browser
Species Human (GRCh38)
Location 2:217979597-217979619
Sequence CCTATAAGGTTCCCGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185747_946185752 5 Left 946185747 2:217979569-217979591 CCCATTACCAGAAGCTGGAATCA 0: 1
1: 0
2: 1
3: 14
4: 149
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185749_946185752 -2 Left 946185749 2:217979576-217979598 CCAGAAGCTGGAATCAAATTTCC 0: 1
1: 0
2: 0
3: 7
4: 170
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185746_946185752 8 Left 946185746 2:217979566-217979588 CCTCCCATTACCAGAAGCTGGAA 0: 1
1: 0
2: 3
3: 30
4: 261
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185748_946185752 4 Left 946185748 2:217979570-217979592 CCATTACCAGAAGCTGGAATCAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185752 Original CRISPR CCTATAAGGTTCCCGAAGCC TGG Intronic
900120170 1:1045469-1045491 CCTCGAAAGTTCCAGAAGCCAGG - Exonic
905339043 1:37265840-37265862 CCTAAAAGCCTCCTGAAGCCAGG + Intergenic
906178946 1:43801451-43801473 TCTTGAAGGTTCCTGAAGCCAGG - Intronic
907251838 1:53144656-53144678 CTTATAAGCTTCCTGAAGGCAGG - Intergenic
908550857 1:65207358-65207380 CCTATAAGCTTCCTGAGGGCAGG + Intronic
912158099 1:106947077-106947099 CATATGAAGTTCACGAAGCCTGG - Intergenic
920654050 1:207861918-207861940 CCTAGAATGTTCAAGAAGCCAGG - Intergenic
920682598 1:208084280-208084302 CCTGGAAGGCTCCGGAAGCCAGG + Intronic
1062794670 10:335558-335580 CCTAGAATCTTCCCAAAGCCTGG - Intronic
1072845695 10:98827733-98827755 GCTTTAAGGTTGCTGAAGCCAGG + Intronic
1075022404 10:118961407-118961429 CCAGTGAGGTTCCTGAAGCCTGG + Intergenic
1075889599 10:125935272-125935294 ACTATAAGCTTCCTGAAGGCAGG + Intronic
1083253084 11:61481058-61481080 CCTAGAAGGTCTCAGAAGCCTGG + Intronic
1084270574 11:68027149-68027171 CCTCTAAGGCTCCCCAAGCCTGG + Intronic
1096067999 12:48756328-48756350 CATATAAAGTTCTGGAAGCCTGG - Intergenic
1098226811 12:68332559-68332581 CCAATAAGGCTCCCGGAACCGGG + Intergenic
1107298952 13:38945801-38945823 CCTAGAATGTTCCAGAGGCCAGG - Intergenic
1121482242 14:94288159-94288181 GCTATAAGTTTCCTGAAGGCAGG - Intronic
1124610725 15:31206677-31206699 CCTATAAGGTACCCCCAGCATGG + Intergenic
1127990482 15:64111721-64111743 CATAAAAGGTTCCTTAAGCCAGG + Intronic
1134001783 16:10788520-10788542 CCCGTAAGGTACCCGAAGTCCGG + Intronic
1141749241 16:85947113-85947135 CCTGCCAGGTTCCCCAAGCCTGG - Intergenic
1143069292 17:4277022-4277044 CAGACAAGGTTCCCGAAGCTTGG + Intronic
1144357252 17:14458084-14458106 CCATTAAGGTTCCTGAAACCAGG - Intergenic
1152592071 17:81218650-81218672 CCAAGCAGGTTCCCAAAGCCTGG - Intronic
1162931698 19:13960835-13960857 CCCAGAAGGTTCCAGAAGGCAGG - Intronic
1165431666 19:35776442-35776464 CCCATAAGGTTCCCCAAGGCAGG - Intronic
925217534 2:2110457-2110479 CCTCCAAGTTTCCCAAAGCCAGG + Intronic
927509596 2:23636088-23636110 CCTAGAAGCTTCCAGAACCCGGG + Intronic
927826579 2:26313641-26313663 CCTATGCGGGCCCCGAAGCCTGG + Intronic
935816670 2:106852490-106852512 CCTGTAAGGTTCCCGAAGGTGGG + Intronic
946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG + Intronic
946216257 2:218186080-218186102 CATATAAGCTTCACGAAGGCAGG + Intergenic
947202266 2:227624764-227624786 ACTATAGGGTTCACGCAGCCTGG - Intronic
1178296198 21:31412484-31412506 CTTATAAGGTGCACGAAGCCAGG + Intronic
1179949790 21:44703217-44703239 TCTCTAGGGTTGCCGAAGCCAGG - Intronic
1181549732 22:23630817-23630839 CCTATCAGGAACCTGAAGCCAGG + Intronic
1182689176 22:32144597-32144619 CCTATCAGGAACCTGAAGCCAGG + Intergenic
959826995 3:110809616-110809638 TCTATAAGGTTCACCAAGACAGG + Intergenic
966461118 3:180177475-180177497 ACTGTAAGGTTCATGAAGCCAGG - Intergenic
968806357 4:2775548-2775570 CGTATACGGTTCCAGGAGCCTGG - Intergenic
978649028 4:110978158-110978180 CCTATAAGCTTTCTGAAGGCAGG + Intergenic
981842096 4:149124455-149124477 CCTATAATATTCCTGCAGCCTGG - Intergenic
988974188 5:36499160-36499182 CCTAAAATGTTCCAGAAGGCAGG + Intergenic
994432496 5:99685425-99685447 GCTAAAAGTTTCCCCAAGCCAGG - Intergenic
998251973 5:140559502-140559524 CCTATGAGGTCCCCCAAACCTGG + Intronic
1004280558 6:14276231-14276253 CCTAGAAGGTTCCCCAAACCAGG + Intergenic
1018370770 6:163165722-163165744 CCAGTTAGCTTCCCGAAGCCTGG - Intronic
1019521215 7:1461334-1461356 CCTCCAGGGTCCCCGAAGCCAGG + Intergenic
1021761372 7:23905285-23905307 GCTTTAAGGTCCCGGAAGCCAGG - Intergenic
1023068126 7:36400298-36400320 CCTATAAGGTTTCTTAAGGCAGG + Intronic
1024302416 7:47897318-47897340 CTGATCAGGTTCCCGCAGCCTGG + Intronic
1026987218 7:74562151-74562173 CTCACACGGTTCCCGAAGCCTGG + Intronic
1033213990 7:139481037-139481059 CATATAAGGCTCCTGAAGCTGGG - Intronic
1034506728 7:151498166-151498188 CCTTGAAGGTTCCTCAAGCCAGG - Intronic
1035149729 7:156859880-156859902 CCTATAAGTCTCCTGAAGTCAGG - Intronic
1037688805 8:21165823-21165845 CCTAAGAGCTTCCAGAAGCCAGG - Intergenic
1050159201 9:2699464-2699486 CATATAAGATTCCGGAAGGCAGG - Intergenic
1190776013 X:53552783-53552805 CCTCTAAGGTACAGGAAGCCAGG + Exonic
1201867419 Y:18670019-18670041 CCAATGAGGGTCCTGAAGCCAGG + Intergenic