ID: 946185752

View in Genome Browser
Species Human (GRCh38)
Location 2:217979597-217979619
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185748_946185752 4 Left 946185748 2:217979570-217979592 CCATTACCAGAAGCTGGAATCAA 0: 1
1: 0
2: 0
3: 18
4: 190
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185747_946185752 5 Left 946185747 2:217979569-217979591 CCCATTACCAGAAGCTGGAATCA 0: 1
1: 0
2: 1
3: 14
4: 149
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185749_946185752 -2 Left 946185749 2:217979576-217979598 CCAGAAGCTGGAATCAAATTTCC 0: 1
1: 0
2: 0
3: 7
4: 170
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54
946185746_946185752 8 Left 946185746 2:217979566-217979588 CCTCCCATTACCAGAAGCTGGAA 0: 1
1: 0
2: 3
3: 30
4: 261
Right 946185752 2:217979597-217979619 CCTATAAGGTTCCCGAAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type