ID: 946185967

View in Genome Browser
Species Human (GRCh38)
Location 2:217980452-217980474
Sequence ACAGTGTGGGCTCCTTCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 226}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946185956_946185967 14 Left 946185956 2:217980415-217980437 CCATCCAAATAGAGGAAACGTCC 0: 1
1: 0
2: 0
3: 5
4: 67
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185948_946185967 27 Left 946185948 2:217980402-217980424 CCCTTGCCCCACCCCATCCAAAT 0: 1
1: 0
2: 0
3: 43
4: 389
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185947_946185967 30 Left 946185947 2:217980399-217980421 CCTCCCTTGCCCCACCCCATCCA 0: 2
1: 0
2: 10
3: 155
4: 1370
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185952_946185967 20 Left 946185952 2:217980409-217980431 CCCACCCCATCCAAATAGAGGAA 0: 1
1: 0
2: 1
3: 13
4: 174
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185954_946185967 16 Left 946185954 2:217980413-217980435 CCCCATCCAAATAGAGGAAACGT 0: 1
1: 0
2: 0
3: 2
4: 90
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185959_946185967 -7 Left 946185959 2:217980436-217980458 CCCCTTTGTTGGTCCAACAGTGT 0: 1
1: 0
2: 0
3: 8
4: 107
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185953_946185967 19 Left 946185953 2:217980410-217980432 CCACCCCATCCAAATAGAGGAAA 0: 1
1: 0
2: 0
3: 16
4: 203
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185949_946185967 26 Left 946185949 2:217980403-217980425 CCTTGCCCCACCCCATCCAAATA 0: 1
1: 0
2: 6
3: 49
4: 494
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185960_946185967 -8 Left 946185960 2:217980437-217980459 CCCTTTGTTGGTCCAACAGTGTG 0: 1
1: 0
2: 1
3: 10
4: 100
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185951_946185967 21 Left 946185951 2:217980408-217980430 CCCCACCCCATCCAAATAGAGGA 0: 1
1: 0
2: 1
3: 15
4: 170
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185957_946185967 10 Left 946185957 2:217980419-217980441 CCAAATAGAGGAAACGTCCCCTT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185961_946185967 -9 Left 946185961 2:217980438-217980460 CCTTTGTTGGTCCAACAGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 115
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226
946185955_946185967 15 Left 946185955 2:217980414-217980436 CCCATCCAAATAGAGGAAACGTC 0: 1
1: 0
2: 1
3: 3
4: 55
Right 946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG 0: 1
1: 0
2: 2
3: 18
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946185967 Original CRISPR ACAGTGTGGGCTCCTTCCAG GGG Intronic
900241673 1:1620282-1620304 ACAGTGTGGGCTCATGGCATTGG + Intronic
900314697 1:2050884-2050906 ACAGCGCGGGCTCCTTCCCCGGG + Intronic
900597672 1:3489863-3489885 TCTGTGTGGGCTCCTCCCTGGGG - Intergenic
900682182 1:3923138-3923160 GCAGGGCTGGCTCCTTCCAGAGG - Intergenic
902489956 1:16774222-16774244 GCAGGGTCAGCTCCTTCCAGAGG - Intronic
902724404 1:18325339-18325361 ACTGGGTGGTCTCCTTCCATTGG - Intronic
904921767 1:34013618-34013640 GTAGTGTCAGCTCCTTCCAGAGG - Intronic
905303451 1:37001427-37001449 ACAGTGTAGTTTCCTGCCAGGGG - Intronic
905925190 1:41744681-41744703 ATAGGGTGGGCTCATTCAAGGGG + Intronic
906143131 1:43545500-43545522 ACAGTGTGAGCTACAGCCAGGGG + Intronic
908677981 1:66627483-66627505 AGTGTGTGGGCTACTTCCATAGG + Intronic
909447040 1:75759183-75759205 CCAGAGTTGGTTCCTTCCAGTGG - Intronic
913241578 1:116834773-116834795 ACAGTGTGTGGTCCTCCCTGGGG + Intergenic
914931089 1:151934182-151934204 AGAATGTGGGCTCCCTCTAGAGG - Intergenic
915362361 1:155293843-155293865 ACAGTGTGGGCTGGGTGCAGTGG + Intronic
915495456 1:156279435-156279457 ACAGCGTGTGCTCTTTCCATTGG - Intronic
916476859 1:165177759-165177781 ACAGGGATGGTTCCTTCCAGAGG - Intergenic
916770069 1:167899239-167899261 CCAGCCTGGGCTCCTCCCAGAGG + Intronic
923530483 1:234808306-234808328 GCAGGGTCAGCTCCTTCCAGAGG + Intergenic
923889119 1:238191688-238191710 ACAGAGTTTGCTCCTTCCCGAGG + Intergenic
1063372635 10:5531824-5531846 GCAGGGTGGGTTCCTTCCAGAGG - Intergenic
1063568394 10:7192706-7192728 GCAGTTTGGGATCTTTCCAGTGG - Intronic
1063959880 10:11298253-11298275 GCTGTGGGGGCTCCTCCCAGGGG - Intronic
1064677398 10:17775086-17775108 ACAGTGTAGGCTGGTTGCAGTGG - Intronic
1067083640 10:43227119-43227141 ACAGTTTGGTCTCCTTCCTCTGG + Intronic
1067754127 10:48992042-48992064 ACACTTTGGGCTCCTTCAACAGG - Intergenic
1068404521 10:56572709-56572731 CCAGAGTTGGTTCCTTCCAGTGG + Intergenic
1069273393 10:66559396-66559418 ACAATATTGCCTCCTTCCAGAGG + Intronic
1069371259 10:67750206-67750228 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
1069526204 10:69174240-69174262 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
1070123899 10:73604731-73604753 CCAGAGTTGGTTCCTTCCAGTGG + Intronic
1072194863 10:93108656-93108678 ATAGTGTGGGCTGCGTGCAGTGG - Intergenic
1072458719 10:95600296-95600318 ACACAGTCGGCTCCCTCCAGGGG + Intergenic
1074124422 10:110516790-110516812 TCATTCTGGGCTTCTTCCAGAGG + Intergenic
1074265185 10:111894852-111894874 CCAGAGTTGGTTCCTTCCAGTGG + Intergenic
1076221767 10:128739565-128739587 TCAGGGTGGGCTCCTCACAGGGG - Intergenic
1076872375 10:133200316-133200338 AGACTGTGGCCTCCTCCCAGTGG + Intronic
1077087906 11:763727-763749 ACAGCTTGGTCTCTTTCCAGGGG + Exonic
1078066434 11:8081814-8081836 GCAGTGTGGACTCCTTCCCCAGG - Intronic
1078545058 11:12241159-12241181 GCAGGTAGGGCTCCTTCCAGTGG + Exonic
1078842577 11:15092332-15092354 ACAGTGTCAGCTCTTTCTAGGGG + Intergenic
1079461510 11:20683473-20683495 ACACTGAGGACTACTTCCAGCGG - Intronic
1080889937 11:36400798-36400820 ACAGTGTGGTCACCCTCAAGTGG - Intronic
1081341758 11:41936655-41936677 ACAGTATGGCCTTTTTCCAGAGG + Intergenic
1081795564 11:45816974-45816996 ACAGTCTGGGCTCAGGCCAGGGG - Intergenic
1084618033 11:70249550-70249572 GCAGGGTGGGTTCCTTCCGGAGG + Intergenic
1085096931 11:73768856-73768878 ACAGTGTGCAGTCTTTCCAGAGG + Intergenic
1085730853 11:78997265-78997287 ATAGTGTGAGCTCTTTGCAGAGG - Intronic
1088391994 11:109324602-109324624 ACAGTGTGGTCTCAGTCTAGAGG - Intergenic
1091573282 12:1710402-1710424 CCAGAGTTGGTTCCTTCCAGTGG - Intronic
1092591947 12:9960164-9960186 TCACTGTGGGATCCCTCCAGGGG + Intronic
1093067952 12:14678447-14678469 ACAGTAAGGACTCCTTCCAGGGG + Intronic
1097233537 12:57525875-57525897 ACCGTGGGGGCCCCTCCCAGGGG - Exonic
1098456596 12:70681324-70681346 ACAATGTGGGCTCCTTCTCTGGG + Intronic
1099554641 12:84096874-84096896 AAAGTGTGAGTTCTTTCCAGAGG - Intergenic
1101530376 12:105568118-105568140 GCAGTATTGGATCCTTCCAGTGG - Intergenic
1103061722 12:117863746-117863768 ACAGGGCTGGTTCCTTCCAGAGG + Intronic
1104389269 12:128377857-128377879 GCAGTGTGGGCTCCTTCCCCAGG + Intronic
1104607733 12:130202400-130202422 GCAGGGTTGGCTCCTCCCAGTGG + Intergenic
1104779113 12:131408418-131408440 ACAGTGGAGGCAGCTTCCAGAGG - Intergenic
1104971483 12:132532796-132532818 ACGGGGTGGGCTCCTTCCTCAGG - Intronic
1105892201 13:24689788-24689810 ACAGTGTGGACACCTGACAGGGG - Intronic
1105943896 13:25173715-25173737 ACAGTGAGGGCACCTTCCGCAGG - Intergenic
1106351778 13:28937582-28937604 CCAGAGTTGGTTCCTTCCAGTGG - Intronic
1109375510 13:61486689-61486711 ACAGTGTTGGCTCCTTCCCTGGG + Intergenic
1110481453 13:75982365-75982387 GAAGTGTGGGTTCCTTCTAGAGG - Intergenic
1113144989 13:107198752-107198774 GCAGGGTTGGCTCCTTCCGGGGG + Intronic
1114601039 14:23955569-23955591 ACATGGTGGGCTGCTTCCTGAGG - Intronic
1114605250 14:23990716-23990738 ACATGGTGGGCTGCTTCCTGAGG - Intronic
1115706795 14:36007524-36007546 ACATAGTTGGCTCCTTCCAAGGG + Intergenic
1116329743 14:43580562-43580584 CCAGTATTGGTTCCTTCCAGTGG + Intergenic
1121408718 14:93734758-93734780 AGATAGTGGGCTTCTTCCAGGGG - Intronic
1125761634 15:42100189-42100211 ACAGTACAGTCTCCTTCCAGAGG + Intergenic
1128025217 15:64430361-64430383 ACAGCATGGGCTCCTTCCAGGGG - Intronic
1128895104 15:71365862-71365884 ACTGTGTTGGCAACTTCCAGTGG - Intronic
1128931176 15:71706164-71706186 ACAGTGTGGGCACCAACCTGGGG + Intronic
1129181983 15:73883395-73883417 AAGGTGTTGGCTCCTTCCAAAGG + Intronic
1130177576 15:81591000-81591022 CCACAGTTGGCTCCTTCCAGTGG - Intergenic
1131782218 15:95871994-95872016 CCGGAGTTGGCTCCTTCCAGTGG + Intergenic
1132221554 15:100109066-100109088 GCAGTGGGGACTCCTTCCCGAGG + Exonic
1133765052 16:8832164-8832186 GCATGGTGGGCTCCTTCCTGGGG - Intronic
1134591545 16:15458224-15458246 ACAGTGTGTGCTATTTACAGAGG - Intronic
1136237108 16:28921351-28921373 AGAGTGAGGGCTCCTTCCTCTGG - Intronic
1137814846 16:51388809-51388831 CCAATGTTGGCTGCTTCCAGCGG + Intergenic
1138954042 16:61949611-61949633 CCAGAGTTGGTTCCTTCCAGTGG - Intronic
1139641713 16:68296477-68296499 GCCGCTTGGGCTCCTTCCAGCGG - Exonic
1141534562 16:84670153-84670175 TCAGTGAGGGCTGCTCCCAGAGG + Intergenic
1141583886 16:85020094-85020116 GGATTGTGGGCTCTTTCCAGAGG - Intergenic
1141919964 16:87129071-87129093 GCAGGGCTGGCTCCTTCCAGAGG + Intronic
1142381029 16:89732315-89732337 ACAGGCTGGGCTCCCTGCAGTGG + Intronic
1144208209 17:12994009-12994031 AGAGGGTGGGCTTCATCCAGGGG - Intronic
1146658238 17:34647926-34647948 CCAGCCTGGGCCCCTTCCAGAGG + Intergenic
1148559093 17:48595937-48595959 GTAGTATGTGCTCCTTCCAGTGG + Exonic
1148951742 17:51319269-51319291 ACAGTCTAAGCTCATTCCAGTGG + Intergenic
1149211479 17:54307205-54307227 AAAGTGTTGGTTCTTTCCAGAGG - Intergenic
1150689828 17:67355377-67355399 ACAGTGTTGGCTCAGTGCAGTGG - Intronic
1152342774 17:79734326-79734348 ACACTCAGGGCTCCTTCCACCGG + Intronic
1154154924 18:11936600-11936622 ACAGTGAGGGCGCTTCCCAGGGG + Intergenic
1154390821 18:13934665-13934687 AGAGTGTGGCCTCCATCCTGGGG + Intergenic
1160042777 18:75360731-75360753 GCAGGGTGGGCTCCTTCTGGAGG + Intergenic
1161598512 19:5165402-5165424 CCAGAGTTGGTTCCTTCCAGTGG + Intronic
1162019478 19:7862142-7862164 TCCGTGGGGACTCCTTCCAGCGG - Exonic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1165283187 19:34815329-34815351 ACATTGGGGGATCCTGCCAGGGG - Intergenic
1166230378 19:41422950-41422972 TCAGTGTGGGCTCCCTGGAGTGG - Intronic
1167119420 19:47507758-47507780 GAGCTGTGGGCTCCTTCCAGGGG - Intronic
1168100983 19:54140819-54140841 ACAGTGTGGTCTCCTGTCTGTGG + Intronic
1168551928 19:57303154-57303176 ACAGTGTCAGCTCCTTCCTCAGG + Intergenic
926061015 2:9804905-9804927 ACAGGGTTGGTTCCTTCCAAGGG - Intergenic
926219068 2:10923124-10923146 TCAGGCTGGGCTCCATCCAGGGG + Intergenic
926228158 2:10983123-10983145 ACAGTGTGGGCTCCTCACACAGG + Intergenic
926715386 2:15920036-15920058 TCAGTGGGGGCACCTGCCAGAGG - Intergenic
926841573 2:17086752-17086774 ACAGGGTTGGCTCCTTCCCAGGG - Intergenic
929158647 2:38810575-38810597 ACAGTGGGGGCTCCTGGCAGAGG + Intronic
933435171 2:82240255-82240277 TCAGTGTGGACTTCTTGCAGAGG + Intergenic
933611344 2:84439136-84439158 CCAGAGTTGGTTCCTTCCAGTGG - Intronic
933813863 2:86050402-86050424 ACGGTGTGGCCTGCTTACAGAGG - Intronic
938113196 2:128583722-128583744 GCAGGGTTGGTTCCTTCCAGAGG + Intergenic
939538272 2:143460823-143460845 CCAGAGTGGGCAGCTTCCAGGGG + Intronic
941327249 2:164131541-164131563 AAGGTGTGGGCTCCTGCCACAGG + Intergenic
942111697 2:172688873-172688895 CCAGAGTTGGTTCCTTCCAGTGG + Intergenic
946185967 2:217980452-217980474 ACAGTGTGGGCTCCTTCCAGGGG + Intronic
946332209 2:219016815-219016837 ACAGTTTGGACTTCTTCCTGAGG - Intronic
946381591 2:219352613-219352635 AAAGTGGGGGCGCCCTCCAGTGG + Intergenic
947451894 2:230216468-230216490 ACAGGGTTGGTTCCTTCTAGAGG - Intronic
947972600 2:234336707-234336729 AGAGTGTGGACTCCTGACAGTGG - Intergenic
948111721 2:235461677-235461699 GCAGGGTGGGTTCCTTCCTGGGG - Intergenic
1169553607 20:6726700-6726722 ACTTTGGGGGCTCCTTCCTGGGG - Intergenic
1170208394 20:13823688-13823710 ACAGTAAGGGCGCCTTCAAGAGG - Intergenic
1171933122 20:31246488-31246510 ACAGTGTGGGCTCCTTCTCTGGG - Intergenic
1173291046 20:41715584-41715606 TCAGTGTGGGCTGCTTTCTGAGG - Intergenic
1173728794 20:45314433-45314455 ACAGTGTGCGCTCCTTGATGTGG + Exonic
1175003971 20:55662605-55662627 AGAGTGTGGGCCCCATGCAGTGG + Intergenic
1179194869 21:39155585-39155607 ACAGAATGGGCTCCCTGCAGTGG + Intergenic
1179546500 21:42115651-42115673 ACAGTGGGAGAACCTTCCAGAGG - Intronic
1180703392 22:17794101-17794123 ACAGTGTGGATTCCTCCAAGAGG + Intronic
1184264100 22:43337569-43337591 CCAGCCTGGCCTCCTTCCAGAGG + Intronic
1184982241 22:48102830-48102852 AGGGTGGGGGCTCCTTCCAGGGG - Intergenic
1185128464 22:49024621-49024643 GCAGTGCAGGCTCCTTCCGGTGG + Intergenic
1185134919 22:49064012-49064034 ACAGGGTGGACTCTGTCCAGAGG + Intergenic
951239176 3:20270204-20270226 CCAGAATTGGCTCCTTCCAGTGG - Intergenic
952236732 3:31487632-31487654 TGACTGTGGGCTGCTTCCAGTGG - Intergenic
953364235 3:42328530-42328552 GCAGGGTTGGCTCCTTCTAGAGG + Intergenic
953507776 3:43503253-43503275 ACAATATGGGCTCCCTCTAGTGG + Intronic
955596503 3:60596227-60596249 ACAGTGTTGGCTTCTTCCCTAGG + Intronic
956772448 3:72537958-72537980 ACTGAGTGGGGCCCTTCCAGTGG + Intergenic
960063374 3:113346989-113347011 CCAGAGTTGGTTCCTTCCAGTGG - Intronic
960144815 3:114189782-114189804 ACAGTGTCACCTTCTTCCAGGGG - Intronic
961365241 3:126395305-126395327 AGAGTGGGGGCCCTTTCCAGAGG + Intronic
964877531 3:161385201-161385223 GCAGTGTGTGCTCCTTCCACAGG + Intergenic
967550492 3:190789131-190789153 ACAGGGTTGGTTCCTTCTAGAGG + Intergenic
967827141 3:193886045-193886067 ATAGTTTGGCCTGCTTCCAGTGG - Intergenic
968763124 4:2452544-2452566 AGAGTGCCTGCTCCTTCCAGTGG + Intronic
969421275 4:7097913-7097935 GCAGGGTGGGTTCCTTCTAGGGG - Intergenic
972026115 4:34380263-34380285 CCAGCCTGGGCTCATTCCAGAGG + Intergenic
974735153 4:65921047-65921069 CCAGAGTTGGCTCCTTCCAGTGG + Intergenic
982196904 4:152925622-152925644 TCAGTGTGGGCTCAGTCCAGAGG - Intergenic
985657144 5:1138052-1138074 CCAGAGTTGGTTCCTTCCAGTGG + Intergenic
985986788 5:3522714-3522736 GCAGTGTTGGCTCCTTCATGGGG - Intergenic
987639399 5:20593153-20593175 TCAGTGTCAGCTCCTCCCAGTGG - Intergenic
987676697 5:21083711-21083733 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
988631273 5:32934168-32934190 TAAATGTGGGCCCCTTCCAGGGG + Intergenic
988673298 5:33405463-33405485 ACAGTGTTTGTCCCTTCCAGAGG + Intergenic
990419561 5:55617928-55617950 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
991510918 5:67375656-67375678 AGAGGGTAGCCTCCTTCCAGGGG + Intergenic
992842113 5:80705676-80705698 ACAGTATTGGCTCCTTCTTGAGG + Intronic
995658173 5:114450344-114450366 ACACTGTGAGCTCCTCCAAGAGG - Intronic
997468368 5:134103007-134103029 ACAGTGAGGGCTCCTGCGGGAGG - Intergenic
997715935 5:136042894-136042916 ACACTGAGAGCACCTTCCAGAGG + Intronic
997771334 5:136556964-136556986 ACAGTGTCAGCTCCTTCCCTTGG + Intergenic
998503648 5:142654753-142654775 TTAGGGTTGGCTCCTTCCAGGGG + Intronic
999073970 5:148777547-148777569 ACAGTCTGGGCACCCTCCATGGG + Intergenic
999605890 5:153315435-153315457 CCAGAGTTGGCTCCTTCCAGTGG + Intergenic
999844316 5:155461815-155461837 ACAATGAGGGCATCTTCCAGAGG - Intergenic
1000168253 5:158676601-158676623 CCAGTGTGGGCTTCTTCCAGAGG - Intergenic
1001404793 5:171468488-171468510 CCAGTGAGGACTCCTGCCAGTGG + Intergenic
1002687330 5:181024029-181024051 ACAATGTGGGCTCCTTCTCTGGG - Intergenic
1004232267 6:13844114-13844136 ACAGTGTTGGTTCCTTCTGGAGG - Intergenic
1004295731 6:14408556-14408578 ACAATATGGGCTTCCTCCAGGGG + Intergenic
1005375552 6:25178921-25178943 GTAGGGTTGGCTCCTTCCAGAGG + Intergenic
1005705203 6:28444423-28444445 CCAGAATTGGCTCCTTCCAGTGG + Intergenic
1007385903 6:41520018-41520040 CCAGGGTGGGGGCCTTCCAGGGG + Intergenic
1009687973 6:66987914-66987936 CCAGAGTTGGTTCCTTCCAGTGG + Intergenic
1013401570 6:109801660-109801682 TCGGTGTGGGCTTCTACCAGGGG + Intronic
1017591590 6:155983996-155984018 ACAGTGTGGCCTCATCACAGTGG - Intergenic
1019177491 6:170167639-170167661 CCAGTGCGGGCTCCTTGCTGAGG + Intergenic
1020187631 7:5970980-5971002 ACAGTGCTGGTTCCTTCCAGAGG + Intergenic
1020270816 7:6594415-6594437 ACTGTGTGGCTTCTTTCCAGCGG + Exonic
1020295286 7:6753790-6753812 ACAGTGCTGGTTCCTTCCAGAGG - Intergenic
1020347822 7:7183336-7183358 AGCGAGCGGGCTCCTTCCAGAGG + Intronic
1021572380 7:22079333-22079355 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
1023750060 7:43363710-43363732 ACAAAGGGGGCTCCTCCCAGTGG - Intronic
1024375605 7:48635053-48635075 ACTGGGAGGGCTCCTTCCAGTGG + Intronic
1024664035 7:51528213-51528235 CCAGTGTGGGCTCCTACAACTGG + Intergenic
1026502903 7:70958092-70958114 CCAGTGTGGGCTCCTGCACGTGG - Intergenic
1027824110 7:83088807-83088829 ACAGTGTTGCCTCCCTCCTGAGG + Intronic
1029135944 7:98371479-98371501 ATAGTGTGTGCTGGTTCCAGCGG - Intronic
1030427190 7:109393469-109393491 ACAGTATGTGTGCCTTCCAGAGG - Intergenic
1031204107 7:118732098-118732120 TCAGGGTAGGCTTCTTCCAGTGG + Intergenic
1032722910 7:134565402-134565424 CCAGAGTTGGTTCCTTCCAGAGG - Intronic
1033446963 7:141431651-141431673 CCATTCTGGGCTCTTTCCAGGGG + Intronic
1034377605 7:150659692-150659714 ACATTGTGGAATCCATCCAGGGG - Intergenic
1035202588 7:157276912-157276934 ACAGGGGAGGCTCCCTCCAGGGG - Intergenic
1035397730 7:158546255-158546277 ACAGAGACGGCTCCTTCCACTGG + Intronic
1036769000 8:11566021-11566043 TCAGTGGGGGCTCCTGCTAGTGG + Intergenic
1039276605 8:35939335-35939357 CCAGAGTTGGCTCCTTCCAGTGG - Intergenic
1039407951 8:37328766-37328788 ACCGTGCTGGCTCCTTCCTGTGG + Intergenic
1040138812 8:43886272-43886294 ACAGTTATTGCTCCTTCCAGTGG + Intergenic
1041030270 8:53729518-53729540 TCAGGGTGGGCTACTTCCTGGGG - Intronic
1044098269 8:88097051-88097073 ACAGAATGGGCTCCTTCACGTGG + Intronic
1044286689 8:90418737-90418759 GCAATGTTGGCTTCTTCCAGAGG - Intergenic
1044534791 8:93346077-93346099 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
1048020424 8:130533361-130533383 ACAGGGTTAGTTCCTTCCAGAGG - Intergenic
1048336722 8:133507991-133508013 AGAGGGTGGGCACCTCCCAGGGG - Intronic
1048340567 8:133535475-133535497 ACAGTATGTGCTCATTCCATTGG + Intronic
1050835408 9:10072354-10072376 CCAGAGTTGGTTCCTTCCAGTGG + Intronic
1052732387 9:32304585-32304607 AGACTGTGGGCTCCTTGCGGAGG + Intergenic
1053123286 9:35561360-35561382 TCAGTTTTGGCTGCTTCCAGGGG - Exonic
1053532484 9:38896410-38896432 TCAGGGTTGGTTCCTTCCAGTGG + Intergenic
1053577797 9:39370605-39370627 ACAGTGTGGGCTTTTTTCAATGG + Intergenic
1053842306 9:42198548-42198570 ACAGTGTGGGCTTTTTTCAATGG + Intergenic
1054099373 9:60929322-60929344 ACAGTGTGGGCTTTTTTCAATGG + Intergenic
1054120770 9:61204946-61204968 ACAGTGTGGGCTTTTTTCAATGG + Intergenic
1054192290 9:61994993-61995015 CCAGTGTTAGCTCCTTTCAGTGG - Intergenic
1054204709 9:62120831-62120853 TCAGGGTTGGTTCCTTCCAGTGG + Intergenic
1054586976 9:66977608-66977630 ACAGTGTGGGCTTTTTTCAATGG - Intergenic
1054633650 9:67467527-67467549 TCAGGGTTGGTTCCTTCCAGTGG - Intergenic
1054646116 9:67593698-67593720 CCAGTGTTAGCTCCTTTCAGTGG + Intergenic
1055990334 9:82099116-82099138 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
1057343536 9:94225908-94225930 CCAGAGTTGGTTCCTTCCAGCGG - Intergenic
1057825515 9:98369713-98369735 TCACTGTGGGCTCATCCCAGTGG - Intronic
1058737069 9:107903591-107903613 ACAGTGTGTGTTCCTTCAATGGG + Intergenic
1059496782 9:114716797-114716819 AAAGAGTGGGCTCTTTCCAGAGG - Intergenic
1060778867 9:126397109-126397131 CAAGTGTGGGCTCCTTGCAGAGG + Intronic
1061900828 9:133671139-133671161 AGGGTCTGGGCTTCTTCCAGAGG + Intronic
1062136878 9:134933828-134933850 ACAGTGTGGTCTCCCCACAGAGG + Intergenic
1187151709 X:16687043-16687065 ACAGGGTTGGTTCCTTCTAGAGG - Intronic
1189288515 X:39868859-39868881 ACAGGGAGGGCTTCTTGCAGAGG - Intergenic
1192538042 X:71945430-71945452 CCAGTGTGAGTTCCTTCCTGAGG + Intergenic
1193933236 X:87582703-87582725 CCAGAGTTGGTTCCTTCCAGTGG + Intronic
1194682012 X:96865617-96865639 ACTATTTGGACTCCTTCCAGGGG - Intronic
1196343949 X:114630091-114630113 AGAATGTGAGTTCCTTCCAGAGG + Intronic
1197705603 X:129632468-129632490 AGCGTGTGGGCTGCTGCCAGTGG - Intergenic
1198226736 X:134652339-134652361 ACATTTTGGGGTCCTTCTAGAGG + Intronic
1198255219 X:134918527-134918549 ATAGTGTGGCCTCCTTTCAAGGG - Intergenic
1200775912 Y:7170324-7170346 CCAGAGTTGGTTCCTTCCAGTGG - Intergenic
1201347186 Y:12998167-12998189 ACAGTCACGGCTCCTTCCAAAGG + Intergenic