ID: 946186341

View in Genome Browser
Species Human (GRCh38)
Location 2:217982837-217982859
Sequence CAAGCAGCAAGGTAGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 190}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946186341 Original CRISPR CAAGCAGCAAGGTAGGACCC AGG (reversed) Intronic
901674376 1:10874430-10874452 CAGGTAGCCAGGTGGGACCCAGG + Intergenic
903035207 1:20488364-20488386 TCAGCAGCAAGGAAGGAGCCAGG - Intergenic
904297127 1:29527167-29527189 CAGGCAGCAAGGGAGGACGAAGG + Intergenic
905191311 1:36237170-36237192 AAAGCAGCTAGGTAGGGGCCGGG + Intronic
906041927 1:42794196-42794218 CAGGCAGCCAGCTAGGACCAGGG - Intronic
907407155 1:54260684-54260706 CAAGCAGTAAGGATGGAGCCAGG + Intronic
908209363 1:61884256-61884278 CAATGAGCAAGCTAGGACCTTGG - Exonic
908822722 1:68104547-68104569 CAAGGAGCTAGGAGGGACCCTGG - Intronic
909417806 1:75427090-75427112 CAAGCAGCAGGATCTGACCCTGG - Intronic
912415851 1:109508015-109508037 CAAGCAGCAAGGGATGACCAAGG - Exonic
912719925 1:112011574-112011596 AGAACAGCAAGGCAGGACCCAGG - Intergenic
913374421 1:118134791-118134813 CAGACAGCAAGGTATGACCAAGG - Intronic
913441147 1:118899016-118899038 GAAGCAGCAAGGTAAAGCCCTGG - Exonic
915589645 1:156863147-156863169 CCAGCAGCTAGGCAGGCCCCAGG + Intronic
916443199 1:164847381-164847403 CAGGCAGCAGGGAAGGACACGGG + Exonic
920198113 1:204243031-204243053 CAAGGGGCAAGGCAGGGCCCTGG - Intronic
921181697 1:212636590-212636612 CAAGCTGGAAGGAGGGACCCTGG - Intergenic
921657146 1:217753165-217753187 CAAGGCACAGGGTAGGACCCTGG - Intronic
923480316 1:234377533-234377555 CCAGCATCAACTTAGGACCCGGG + Intronic
923635038 1:235686937-235686959 CAAGCAGCACGGTAGGTTCTGGG - Exonic
924937999 1:248788626-248788648 CAAGCGGCCAGGAAGGAACCTGG + Intergenic
1062858885 10:794519-794541 CCAGCACCAAGGGAGAACCCAGG - Intergenic
1063920407 10:10926754-10926776 CAAGGAGAAAGGTAGGAGTCGGG + Intergenic
1064230050 10:13521760-13521782 CAAGAACCAGGGTGGGACCCAGG + Intronic
1069909781 10:71751991-71752013 CAAGCAAGAAGGCAGGAGCCAGG + Intronic
1070845682 10:79521238-79521260 CAAGCAGGTGGGCAGGACCCAGG + Intergenic
1070928111 10:80239076-80239098 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1071049216 10:81426325-81426347 CAAGCAGCAGAGTAGGAGACAGG + Intergenic
1074085119 10:110203988-110204010 CAAGCAGAATGGTAGGAACAAGG - Intergenic
1074753950 10:116610796-116610818 CAAAAAGCAAGGTAGGTCCCAGG + Intergenic
1075788011 10:125063053-125063075 CCAGCAGCGAGGCAGGGCCCTGG + Intronic
1079385661 11:19977067-19977089 CAAGCAGAAAGGTAGGAAACTGG + Intronic
1081701582 11:45155795-45155817 CAAGCAGAAAAGGAGGATCCAGG + Intronic
1084709703 11:70836316-70836338 CAAGCAGCAAGGGTGGAAGCGGG - Intronic
1088826970 11:113504133-113504155 GCAGAAGCAAGGGAGGACCCTGG + Intergenic
1091298544 11:134490063-134490085 CAAGCAGAAATGGAGGGCCCAGG - Intergenic
1091495213 12:966431-966453 CAAGCAGAAAGATGGGAGCCTGG + Intronic
1093625231 12:21338489-21338511 CAAGCAGCAGGGTGGGGGCCAGG - Intronic
1094746786 12:33353822-33353844 CAAGGAGCAAGGTAGCAGCAGGG - Intergenic
1095481364 12:42639323-42639345 CAAGCAGCGACCTAGGACTCAGG + Intergenic
1096080924 12:48831943-48831965 CAATCAACAAGTTAGGACCAGGG - Intronic
1101348376 12:103905946-103905968 CAAGCAGGAAGGAAGGAGACAGG + Intergenic
1102228428 12:111245809-111245831 CAAACAGAAAAGTAGGACCAGGG + Intronic
1102291645 12:111705599-111705621 CAGGCAGCAAGCTATGAGCCTGG + Intronic
1105443361 13:20433204-20433226 CATGCCCCAAGGGAGGACCCTGG + Intronic
1105546494 13:21354668-21354690 CAAGCAGGAGGGGAGGTCCCAGG - Intergenic
1110706976 13:78607987-78608009 CAAGCAGAAAGGGAGGACGACGG - Intergenic
1111678870 13:91420026-91420048 AAAGTAGCAAGGAAGGATCCTGG + Intronic
1112417069 13:99211913-99211935 GAAGGAGCATGGTAGAACCCAGG - Intronic
1112490493 13:99858988-99859010 CAGGCTGGAAGGAAGGACCCGGG - Exonic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118626800 14:67666973-67666995 CAAACAGCAAGGTGGCATCCTGG + Intronic
1122623174 14:103071158-103071180 CATGCAGCAGGGAAGGAGCCAGG - Intergenic
1123012153 14:105354673-105354695 CAATCAGCAAGGTGGGACCCAGG - Intronic
1123119069 14:105908697-105908719 GTAGCAGCAAGGCAGGTCCCGGG + Intergenic
1131453094 15:92562610-92562632 CAAGCAGCAGGGCAGGAACAGGG - Intergenic
1132308028 15:100831779-100831801 CTAGCAGCGAGGTGGGACTCAGG - Intergenic
1132540927 16:509367-509389 CAAACACCAAGTGAGGACCCAGG - Intronic
1132850100 16:2020998-2021020 CAAGAAGCAAGGTGGGGCTCAGG - Intergenic
1134167577 16:11942735-11942757 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1134493124 16:14710977-14710999 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1134498505 16:14750101-14750123 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1134525057 16:14936731-14936753 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1134547838 16:15124188-15124210 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1134582071 16:15378984-15379006 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1134712647 16:16335218-16335240 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1134720511 16:16378533-16378555 CAAGCAGGCGGGCAGGACCCAGG - Intergenic
1134946916 16:18333352-18333374 CAAGCAGGCGGGCAGGACCCAGG + Intronic
1134954180 16:18373475-18373497 CAAGCAGGTGGGCAGGACCCAGG + Intergenic
1135313004 16:21420387-21420409 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1135365928 16:21852667-21852689 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1135445887 16:22518495-22518517 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1136194586 16:28643064-28643086 CAAGCAGGTGGGCAGGACCCAGG - Intronic
1136255640 16:29037122-29037144 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1136309674 16:29399115-29399137 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1136323117 16:29500895-29500917 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1136437801 16:30240863-30240885 CAAGCAGGTGGGCAGGACCCAGG + Intronic
1138174968 16:54888823-54888845 CAGGCAGGAAGGTAGGACAGAGG + Intergenic
1138304005 16:55957666-55957688 GAAACAGCAAGATTGGACCCAGG - Intergenic
1139310510 16:66024511-66024533 CAAACAACAAGGTGAGACCCAGG + Intergenic
1139334578 16:66222913-66222935 CAAGCACCAAGAGAGGCCCCAGG + Intergenic
1139598670 16:67972870-67972892 CAAGCAGAAATGTAAGACCCAGG - Intergenic
1139857356 16:69991494-69991516 CAAGCAGGTGGGTAGGACCCAGG + Intergenic
1140064659 16:71600804-71600826 CAAGAAGCAGGCTAGGACCAAGG - Intergenic
1140365317 16:74376426-74376448 CAAGCAGGTGGGCAGGACCCAGG - Intergenic
1144366972 17:14554039-14554061 AAAGCAGGAAGTTTGGACCCAGG - Intergenic
1145106981 17:20126015-20126037 CAGGCACCCAGGGAGGACCCAGG - Intronic
1145710537 17:26969320-26969342 CAACCAACCAGGTAGGACCTGGG - Intergenic
1152420875 17:80192505-80192527 CAAGCAGGAAGCCAGGACCAGGG + Exonic
1152623326 17:81377077-81377099 CAAGCAGCAAGATAGGACCAAGG + Intergenic
1153118390 18:1689671-1689693 CAAGTAGCCATGTAGCACCCAGG + Intergenic
1153341978 18:3984744-3984766 CATGCAACAAGGTAGGACTAGGG - Intronic
1153611750 18:6892893-6892915 CAAGCAGGAAGTGAGGACTCAGG - Intronic
1154118803 18:11634742-11634764 CAAGCAGGTGGGCAGGACCCAGG + Intergenic
1155389233 18:25316169-25316191 AAAGCAGCAAGATAAGACCATGG + Intronic
1155438227 18:25834708-25834730 CAAGTAGCAGAGTAGGACTCAGG + Intergenic
1158424408 18:57326194-57326216 CTAGCAACAAGGCAGGAACCAGG + Intergenic
1158974275 18:62696722-62696744 GAGGCAGCAAGGCAGGGCCCAGG - Intergenic
1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG + Intergenic
1159562033 18:70006324-70006346 CAAACAACAAGGTATAACCCAGG - Intronic
1160374521 18:78401376-78401398 CCAGCACCAAGTGAGGACCCTGG + Intergenic
1162472397 19:10880263-10880285 CAAGCAGCCAGGTGTGGCCCAGG - Intronic
1163697661 19:18772142-18772164 CACCCAGCACCGTAGGACCCTGG + Intronic
1167276959 19:48544837-48544859 CATGCAGCCAGTAAGGACCCAGG + Intergenic
1167606223 19:50482294-50482316 CCAGCAGAAAGGGAGGCCCCTGG - Exonic
925449215 2:3953771-3953793 CCTGCAACAAGGTATGACCCTGG + Intergenic
925738905 2:6987759-6987781 CAATCAACAAGGAAGAACCCAGG - Intronic
925971224 2:9107900-9107922 CAAGCAGCAGGGTGGGGCTCAGG + Intergenic
928327953 2:30334981-30335003 CAAGGCTCAAGGCAGGACCCTGG + Intergenic
932310002 2:70732111-70732133 CAGGCAGCAGGGGAGAACCCAGG + Intronic
933849018 2:86350420-86350442 CAAGGAGGAAGGCAGGTCCCTGG + Intergenic
933946528 2:87290877-87290899 CAAGAAGCAAGGAAAAACCCAGG - Intergenic
936333665 2:111570664-111570686 CAAGAAGCAAGGAACAACCCAGG + Intergenic
937065890 2:119017353-119017375 CAGGCAGCAAGGTGACACCCAGG - Intergenic
937368449 2:121281879-121281901 CAAACAGGAAGGAAGGACCTTGG + Intronic
937897163 2:126986539-126986561 CAAGCAGCAAGGAGGAACCAGGG - Intergenic
939649184 2:144740870-144740892 CAATCAGCAAGGAAGGAACAGGG - Intergenic
941166959 2:162092922-162092944 CTAGCAGCTAGCTTGGACCCTGG + Intergenic
941761053 2:169243972-169243994 TTAACAGTAAGGTAGGACCCTGG - Intronic
942524448 2:176838589-176838611 GAAGCAGCAAGCCAGGGCCCTGG + Intergenic
943496565 2:188628507-188628529 AAAGCAGCACGAGAGGACCCAGG - Intergenic
946186341 2:217982837-217982859 CAAGCAGCAAGGTAGGACCCAGG - Intronic
1174451479 20:50623483-50623505 CAAGGAGCAAGGTTTGACCCAGG + Intronic
1175605425 20:60308616-60308638 CTGGCAGCAGGGCAGGACCCTGG - Intergenic
1176163881 20:63662893-63662915 CAAGCAGCTGGGTGGGACCAGGG + Intronic
1178350815 21:31872526-31872548 GCAGCAGCAATGTAGGAACCAGG - Intergenic
1178390791 21:32196391-32196413 CAGGCAGCAAGCTGGGAACCAGG - Intergenic
1180008019 21:45032347-45032369 CCAGCAGCAAGGGAGGCTCCAGG - Intergenic
1181865461 22:25851343-25851365 CATGCAGCAAGTTAGTAGCCAGG + Intronic
1183075728 22:35425743-35425765 CAAGCAGGACGGGAGGACCTTGG - Intergenic
1183936904 22:41267819-41267841 CAAGCAGCTCAGGAGGACCCAGG + Intronic
1185019700 22:48366984-48367006 CTAGCAGCAGGGTTGGACTCAGG - Intergenic
949425226 3:3909047-3909069 CAAACTGCAAGGTAGCAGCCAGG - Intronic
949942058 3:9162722-9162744 CCAGCAGCATGGCTGGACCCTGG + Intronic
955933306 3:64079177-64079199 CAAGCAGCAGGGGTGGAGCCTGG - Intergenic
957512915 3:81213198-81213220 CAAGCAGCAAGCTAGGAAAATGG + Intergenic
961623570 3:128243732-128243754 TAAAGATCAAGGTAGGACCCAGG - Intronic
963005947 3:140726368-140726390 AATGCAGCAAGGAGGGACCCAGG - Intergenic
963526705 3:146424226-146424248 CAAGCACCAAGGAAAGACCAAGG - Intronic
968431254 4:560412-560434 CCAGCTGCAAGGCAGGACCCAGG - Intergenic
975287460 4:72637061-72637083 CAAACTGCAAGGCAGGAGCCAGG - Intergenic
976945243 4:90757687-90757709 CTAGCTGCAAGGTAGAATCCAGG + Intronic
977498211 4:97803482-97803504 CAAGCAGGTATTTAGGACCCAGG + Intronic
978907060 4:114018156-114018178 CAAGAACCAAGGCAGAACCCGGG + Intergenic
982314726 4:154020643-154020665 AAAGAAGCAAGGAAGGATCCTGG - Intergenic
982761540 4:159290118-159290140 CAAGAAGCAAGATAGGACAGTGG + Intronic
987693568 5:21299632-21299654 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991251758 5:64569894-64569916 CAAGTGGCAAGGAAAGACCCAGG - Intronic
991746698 5:69749914-69749936 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991751007 5:69805328-69805350 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991798300 5:70329857-70329879 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991826076 5:70625226-70625248 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
991830294 5:70680223-70680245 CAGCCAGCAAGGAAGGACCTGGG - Intergenic
991890635 5:71329173-71329195 CAGCCAGCAAGGAAGGACCTGGG + Intergenic
1001191849 5:169638628-169638650 GAAGCTGCTAGGTAAGACCCTGG - Intronic
1002449717 5:179311750-179311772 CAAGGAGCAGGGTAGGGGCCAGG - Intronic
1003037771 6:2659998-2660020 GAAGCAGCAAGGAAGGATCTAGG - Intergenic
1004135902 6:12966190-12966212 CCAGCAGCAAGTAAGGACTCAGG + Intronic
1004581522 6:16958711-16958733 GAAGCAGGGAGGGAGGACCCGGG + Intergenic
1007003671 6:38338602-38338624 CAAGCAGAGAGGTAGAACCAGGG + Intronic
1007800699 6:44389758-44389780 CAAGAAGCAAGTTGGGACTCTGG - Intronic
1009305179 6:62080832-62080854 GATGCAGCAAGGTGGGAGCCAGG - Intronic
1010003878 6:70974562-70974584 CAACCTGCAAGGTAGCAGCCTGG + Intergenic
1012081877 6:94769360-94769382 CAAGCAGAAAGGCAGAGCCCTGG - Intergenic
1016825749 6:148386992-148387014 CAAGCACCCAGGTAGTTCCCAGG - Intronic
1016842023 6:148534205-148534227 CCAGCAGCAAGGTTTGACCCGGG - Intronic
1017211321 6:151859906-151859928 TATCCAGCAAGGTAGGAACCAGG - Intronic
1017236993 6:152127072-152127094 CCAGAATCAAGTTAGGACCCAGG + Intronic
1023771557 7:43561186-43561208 CATGAAGCAAGCTAGAACCCCGG + Intronic
1023822764 7:43989004-43989026 CAACCAGCAAGGCTGGACACAGG - Intergenic
1027363902 7:77436813-77436835 GAAGCAGCAAAGTGGAACCCAGG - Intergenic
1028421665 7:90639842-90639864 CAAACTGCAAGGTAGCAGCCAGG - Intronic
1029127671 7:98305937-98305959 CAGGCAGGAAGGATGGACCCAGG + Intronic
1029315587 7:99710263-99710285 GAAGAAGCAAGCTAGGAACCAGG - Intronic
1029436887 7:100568591-100568613 CCAGCAGGCAGGTGGGACCCAGG - Intergenic
1029751029 7:102542419-102542441 CAACCAGCAAGGCTGGACACAGG - Intronic
1029768982 7:102641530-102641552 CAACCAGCAAGGCTGGACACAGG - Intronic
1033607716 7:142939660-142939682 GCAGCAGCAAGATAGGAACCAGG - Exonic
1035397793 7:158546547-158546569 CCAGCAGCCAGGAAGCACCCTGG + Intronic
1035584320 8:760238-760260 CAGGCAGCAAGGGAGGAGACAGG - Intergenic
1036172751 8:6506087-6506109 CAAGAAACAATGTAGGAACCTGG - Intronic
1036439299 8:8766114-8766136 CAACCAGCAATGAAGGACTCAGG + Intergenic
1036655694 8:10675760-10675782 AAAACAGCAAAGTAGGACCATGG + Intronic
1037584097 8:20264705-20264727 CAACCAGCCAGGCAGGACCTCGG + Intronic
1037696045 8:21224825-21224847 CAAGTGGCAAGAGAGGACCCTGG - Intergenic
1043374797 8:79636280-79636302 AAAGCAGCAACATAGGACCCTGG + Intronic
1047479237 8:125265127-125265149 CCAGCTGCAAGGTTGGATCCTGG + Intronic
1048134013 8:131728380-131728402 CAAGCAGCAAGGGAGGGAGCTGG + Intergenic
1048357651 8:133666761-133666783 CAGGCAGCTAGAGAGGACCCAGG - Intergenic
1048868467 8:138778097-138778119 CAAGAAGCAGGGTAGATCCCAGG - Intronic
1049422266 8:142522215-142522237 CAAGCAGCAACTGAGGCCCCAGG - Intronic
1049580293 8:143407863-143407885 CCAGCAGCATTCTAGGACCCAGG - Intergenic
1056598515 9:88027361-88027383 AAAAGAGCAAGCTAGGACCCAGG - Intergenic
1058885209 9:109317765-109317787 CAAGCAGCAAGGCAACACCAGGG + Intronic
1060205980 9:121683103-121683125 CAGGCAGCAAGCTGGGGCCCTGG + Intronic
1062087451 9:134656129-134656151 GAAGCTGCAAGGTGGGGCCCCGG - Intronic
1190321052 X:49179409-49179431 CAGGCATCAAGGGAGGAGCCTGG - Intronic
1192175680 X:68883659-68883681 CAAGCATCAAAGTAGTATCCTGG - Intergenic
1193038456 X:76979013-76979035 CAAACAGCAAGGTGGCAGCCAGG + Intergenic
1194381617 X:93198878-93198900 CTAGCTGCAAGGGAGGACCAAGG + Intergenic
1198361891 X:135903472-135903494 CAGGCAGCATGCCAGGACCCAGG - Intronic
1199596733 X:149511952-149511974 CAATCAGAAAGGTGGGAACCAGG - Intronic