ID: 946187654

View in Genome Browser
Species Human (GRCh38)
Location 2:217990234-217990256
Sequence GAGTGTGGCTGGTGTATAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 206}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946187654 Original CRISPR GAGTGTGGCTGGTGTATAGA TGG (reversed) Intronic
901849420 1:12006284-12006306 GAGTGTGGGATGTGTACAGAGGG - Intronic
904929406 1:34074414-34074436 CATTTTGGCTGGTGTATAGTGGG - Intronic
907258494 1:53197851-53197873 GAGTGTGGATGGGGTACTGAGGG - Intronic
907677488 1:56532105-56532127 GAGTGTGGGTGGTGGAGAAAGGG + Intronic
910589793 1:88918543-88918565 CAGTGGGCCTGGTGTGTAGATGG + Intergenic
911686835 1:100787050-100787072 TTGTGTGGCTCGTGTATGGAGGG + Intergenic
913080317 1:115378752-115378774 TAGAGTGCCTGGTGTATAGAAGG + Intergenic
913611401 1:120512839-120512861 GAGTGTAGGTGGGGTGTAGATGG + Intergenic
914579791 1:149009400-149009422 GAGTGTAGGTGGGGTGTAGATGG - Intronic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
918428591 1:184435629-184435651 CACTGTGCCTGGCGTATAGATGG + Intronic
920663217 1:207937294-207937316 GAATGTGGCTGATGTAGACAGGG - Intergenic
922606485 1:226892771-226892793 GCTTGTGGCTGGTGTCTGGAGGG - Intronic
922618755 1:226978220-226978242 GTGTGTGGTGGGTGTGTAGAGGG - Intronic
922745714 1:228042411-228042433 GATGGTGGGTGGTGGATAGATGG + Intronic
1065173317 10:23053238-23053260 GAGTGGGGAGGGTGTGTAGAAGG + Intergenic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1066556731 10:36622659-36622681 CAGTGTGTCTGGTGTTTATATGG - Intergenic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067549478 10:47223884-47223906 GAGCATGGCTGCTGCATAGATGG + Intergenic
1067790031 10:49281094-49281116 GTGTGGGGCAGGGGTATAGATGG - Intergenic
1067811440 10:49430043-49430065 GAATGTGGTTGGTGAATAGCAGG + Intergenic
1069605022 10:69733396-69733418 CAGTGTGGCTGGGGTGTAGTTGG + Intergenic
1070776341 10:79112047-79112069 TGGTGTGGCTGGAGTGTAGAGGG + Intronic
1070836334 10:79449225-79449247 GAGTGTGGGTGGTTTGAAGAGGG - Intergenic
1073061205 10:100734946-100734968 GAGTGTGGCAGGAGTTTGGAAGG + Intergenic
1074610683 10:115018122-115018144 GAGTGTGCCTGGTGTATTCAAGG - Intergenic
1076502694 10:130949693-130949715 GAGGGAGGCTGGTGCATAGTGGG - Intergenic
1077819955 11:5727459-5727481 GAGTGACCCTGGAGTATAGAGGG + Intronic
1078933795 11:15934981-15935003 GTGTGTGTGTGGTGTAGAGAGGG - Intergenic
1079076148 11:17386590-17386612 GAGTGTGGCTGGTCAATCGTGGG + Exonic
1079870856 11:25795623-25795645 GAGTGTACCTGGTGTGTTGAAGG + Intergenic
1080389176 11:31827849-31827871 GATTGTGCCTGGTGTTTAAAAGG - Intronic
1080415276 11:32064279-32064301 GGGTGTGGATGGTGTAGACAGGG - Intronic
1083196596 11:61092116-61092138 GAATGTGACTGGTGCATAGTAGG - Intergenic
1084176216 11:67423716-67423738 GAGTGAGGCTGATGTGGAGAGGG + Exonic
1085167699 11:74418015-74418037 GAGTGGGGCTGGTGAACATATGG - Intergenic
1086461700 11:87012241-87012263 GCGTGTTTCTGGTGTATAAAAGG - Intergenic
1088527642 11:110773976-110773998 GAGTGGGGATGGTGGATAAATGG + Intergenic
1088878155 11:113952709-113952731 GAATGGGGCTGGGGTAGAGAAGG - Intergenic
1089531538 11:119133005-119133027 GAGTGGGGCTGGTGTTGGGAAGG + Intronic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1091674116 12:2475864-2475886 GAGTGGGGCTGCTGTATAGCTGG + Intronic
1092266379 12:6984011-6984033 GAGTGTTTCTGGAGCATAGATGG - Intronic
1093864701 12:24211110-24211132 GAGTGTGCTTGGTGTGTTGAAGG - Intergenic
1094604557 12:31939344-31939366 GAGGGTGACTGGTTCATAGATGG - Intergenic
1096750095 12:53753041-53753063 GTGTGTGTGTGATGTATAGATGG - Intergenic
1097308035 12:58090559-58090581 GAGAGTGGCTGGTGAGTAGCAGG - Intergenic
1100698243 12:97118773-97118795 GCCTGTGGCTGCTTTATAGAAGG - Intergenic
1101423734 12:104570363-104570385 GAGTGTGGAAGGTTTACAGACGG - Intronic
1103542135 12:121673321-121673343 GTGTGTGGCTGGAGCAGAGACGG - Intergenic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1106031683 13:26010577-26010599 GAATGTGGCAGGTATAAAGAAGG - Intronic
1106044877 13:26129639-26129661 CAGTGTGACTGCTGTGTAGAGGG - Intergenic
1106862346 13:33923431-33923453 TAGTGTGGCTGGTGCATAGTTGG + Intronic
1107632770 13:42359138-42359160 AAGTGAGGCAGGTGTATAAAGGG - Intergenic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110741633 13:79004421-79004443 GTGTGTGTGTGGTGCATAGAGGG - Intergenic
1113263469 13:108592151-108592173 GAGTGTGTTTGGGGTATGGAGGG + Intergenic
1113815375 13:113166382-113166404 GAGTGTGGCTGCCGTGTGGATGG + Intronic
1113946205 13:114045095-114045117 GAATGTGGCTGGCTTCTAGAAGG - Intronic
1117495452 14:56297658-56297680 CAGTGTGACTGGTGGACAGATGG + Exonic
1117753907 14:58954255-58954277 CAGTGTGGCTGGTGCACAGGTGG - Intergenic
1120511171 14:85416197-85416219 GAATGTGGCTGGTGTTTATATGG + Intergenic
1120585873 14:86311795-86311817 GAGTGTCCCTGGTATATTGAAGG - Intergenic
1121007351 14:90498927-90498949 GAATGTGGCTGGTGTGGAGGAGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122117558 14:99535451-99535473 GAGTGTGGCTGGAGCTTGGAGGG - Intronic
1124207316 15:27732561-27732583 GAGTGTGGAGGGTGGAGAGAGGG + Intergenic
1125772787 15:42182459-42182481 GAGACTGGCTGGTGTACAGCAGG + Intronic
1128119401 15:65134529-65134551 GAGAGTGTCTGGTGGAGAGAAGG - Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129067564 15:72919234-72919256 GACTGTGGCTTGTGTATTAAGGG - Intergenic
1129538690 15:76334280-76334302 GTGTGTGTCTGCTGTGTAGATGG - Intergenic
1134665229 16:16013881-16013903 GTGTGTGGCTGGAGCAGAGATGG + Intronic
1134766888 16:16767074-16767096 GTGTATGGATGGTGGATAGATGG - Intergenic
1135780223 16:25293532-25293554 GAGTGTGGCTGAAGCAGAGATGG + Intergenic
1138677687 16:58663917-58663939 GAGTGTGGCTGGAGCGGAGAGGG + Intergenic
1138864653 16:60801798-60801820 GAGTTTTGGTGGTGTAAAGAGGG + Intergenic
1140455945 16:75105607-75105629 CAGTGTGGCTGGTGCAGAGGAGG + Intronic
1141320366 16:83002828-83002850 GAGTGTGCCTAGTGTATTGGAGG + Intronic
1141907925 16:87040021-87040043 GAGTTTGGGCAGTGTATAGATGG + Intergenic
1142152904 16:88520622-88520644 GTGGGTGGATGGTGGATAGATGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1145735724 17:27230061-27230083 GAATATGGATGGTGTATAAAAGG + Intergenic
1146377240 17:32303060-32303082 GATTGTGGCAGGAGTATGGAAGG - Intronic
1146924139 17:36732443-36732465 GATGGTGGCAGGTGGATAGATGG - Intergenic
1149330949 17:55580854-55580876 TAATGTGGCTGTTGTACAGAGGG - Intergenic
1151334536 17:73432140-73432162 GAGTGGGGGTGGGGTAGAGAGGG + Intronic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1151582588 17:74988511-74988533 GAGGGTGGCTTGTGTGTAGAGGG + Intronic
1152355522 17:79805043-79805065 GACTGTGGCTGGGGTATTGGGGG + Intergenic
1152490021 17:80624955-80624977 GAGTGTGGAAGGTGTGTTGAGGG + Intronic
1155517166 18:26635816-26635838 AACTGTGCCTGGTGTGTAGAGGG - Intronic
1158253439 18:55516782-55516804 GAGTGTGGCTGGTGTAGAGTGGG + Intronic
1158519525 18:58159627-58159649 GACTGTGGCTGCTGTGTAGCAGG + Intronic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160151909 18:76401768-76401790 GGGTGTGGTTGGTGGAGAGATGG - Intronic
1160151929 18:76401831-76401853 GGGTGTGGTTGGTGGAGAGATGG - Intronic
1161606811 19:5219645-5219667 GAGAGTGGCTGGAGCAGAGAAGG - Intronic
1161636627 19:5393355-5393377 GACTGTGTCTGGTGTGTCGAAGG - Intergenic
1163545251 19:17937547-17937569 GGGTGTTGCTGGCATATAGAAGG + Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1165597003 19:37017382-37017404 GAGAGTGGCATGAGTATAGAAGG + Intronic
1167487708 19:49772862-49772884 CTGTGTGGCTGGTGCAGAGAGGG + Intronic
1168684555 19:58340358-58340380 CCGTGTGGCTGGTGTATGGAAGG - Exonic
927022043 2:19027594-19027616 GAGTGTGACAGGTGTCTAGAGGG + Intergenic
927056716 2:19372272-19372294 GAGTGAGGCAGGGGTTTAGAGGG + Intergenic
927176122 2:20410063-20410085 TAGTGTGGCTTTTGTAGAGAAGG + Intergenic
927962869 2:27251400-27251422 GAATGTGCCTGGTATATAGAAGG - Intergenic
929357594 2:41044651-41044673 GAGGGTGGAGGGTGAATAGAGGG + Intergenic
932076849 2:68672301-68672323 TAGTGTGGCTGGAGTAAGGAGGG + Intergenic
932996533 2:76861534-76861556 GAGTATGGCTGTTGAAAAGATGG - Intronic
934638677 2:96012883-96012905 CACTGTGCCTGGTGTACAGAAGG - Intergenic
936532606 2:113287174-113287196 TAATGTGGCTGGAGTGTAGAGGG + Intergenic
936662376 2:114556598-114556620 GAGTGGGGCTGGTATTTGGAAGG + Intronic
937263641 2:120602093-120602115 GGGTGTGGCTGGGGTGTGGAGGG - Intergenic
937890871 2:126937583-126937605 GAGTGTGGTTGCTGCGTAGAGGG - Intergenic
938229393 2:129645551-129645573 GAGTGTGGCAGGTGTGTGGAGGG + Intergenic
938729032 2:134131635-134131657 GAGTGTGGATAGTGGATACAGGG - Intronic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941347467 2:164388208-164388230 GAGTGAGGCTGGTGGAGAGAAGG - Intergenic
942618626 2:177823194-177823216 CAATGTGTCTGGTGCATAGAAGG - Intronic
944345483 2:198660294-198660316 GAGTGTGGATGGTGTATTGGAGG + Intergenic
946039421 2:216771088-216771110 GGGTGGGGCGGGTGGATAGATGG - Intergenic
946091928 2:217234471-217234493 GAGTGTGGAGGGTGGAAAGAGGG - Intergenic
946187614 2:217989956-217989978 GTGTGTGGCTGGTGTGTGGATGG - Intronic
946187638 2:217990118-217990140 GTCTGTGGCTGGTGTGTGGATGG - Intronic
946187654 2:217990234-217990256 GAGTGTGGCTGGTGTATAGATGG - Intronic
946187662 2:217990291-217990313 GTGTGTTGCTGGTGTGTGGATGG - Intronic
947526416 2:230879258-230879280 GAGTGTGGCTGGAGGGGAGATGG + Intergenic
947790605 2:232865783-232865805 GATTGTGGCTAATATATAGAGGG - Intronic
948313417 2:237007789-237007811 GTGTGTGGCTGGGGTGGAGAGGG + Intergenic
948775833 2:240288340-240288362 GAGATTGGCTGGTGTCCAGAGGG + Intergenic
1170170015 20:13399890-13399912 GAGTGTGCCTGGTGTGTTGGAGG - Intronic
1172619433 20:36309288-36309310 GGGTGTGGCTGGTGTGGAGAAGG + Intronic
1173659435 20:44723154-44723176 GAGTGTGCCTGGGGTATTTAAGG - Intronic
1176095095 20:63337831-63337853 CAGTGTGGCTGGTGTGTGGGAGG + Intergenic
1178134199 21:29608336-29608358 GAGTGTGTGTGGAGTATAGAAGG + Intronic
1179556826 21:42184286-42184308 GTGTGTGTGTGGTGTATATATGG + Intergenic
1182046885 22:27282084-27282106 AAATGTGGTTGGTGTAAAGAAGG - Intergenic
1183191176 22:36322880-36322902 GAGGGAAGCTGGTGTATACAGGG - Intronic
1183798409 22:40140606-40140628 GAGAGTGGTTGTTGAATAGATGG + Intronic
1184048621 22:41988165-41988187 GATTGGGGCTGGTGTTTGGAGGG + Intronic
950096447 3:10333453-10333475 GACCTTGGCTGGTGTTTAGAGGG + Intronic
950183704 3:10932426-10932448 GAGTGGGGCTGGTGCACAGTAGG - Intronic
957842957 3:85694676-85694698 GAGTGTGTCTGGAGTATAGATGG - Intronic
958177166 3:90011323-90011345 GAGAGTGGCTGGTGTACAGCTGG - Intergenic
958547644 3:95575144-95575166 AAATGTGGATGGTGTATATAAGG + Intergenic
958827948 3:99054836-99054858 GAGAGAGGCTGGTTTAGAGACGG + Intergenic
959128682 3:102323276-102323298 GAGTGTGGCTGGTGCTAGGATGG + Intronic
959269054 3:104181783-104181805 GAGTATGTCTTTTGTATAGATGG - Intergenic
962373734 3:134842371-134842393 GGGTGAGGCTGGTGTAAAGGAGG - Intronic
963638424 3:147828586-147828608 CAGTGTGGAGGATGTATAGACGG + Intergenic
966086189 3:176069070-176069092 TAGTGTGGGTGGTGAAGAGATGG + Intergenic
966351361 3:179035505-179035527 GAGTGTGTGTGGTGTGGAGAGGG - Intronic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
968982720 4:3859252-3859274 GACTGTGCCTGGTATATAGCAGG - Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
971067506 4:23050462-23050484 GAGTGGGGTTGGAGTAGAGAGGG + Intergenic
973728227 4:53797337-53797359 GAGGGTGGCTGTGGTATAGGAGG - Intronic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
974148209 4:57972237-57972259 TACAGTGGCTGTTGTATAGAAGG + Intergenic
976338290 4:83916433-83916455 GAGTGGGAATGATGTATAGATGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981863198 4:149381782-149381804 GAGTTTGGATGGAGTTTAGATGG + Intergenic
985901333 5:2797299-2797321 GAGTGTGGCAGGTGCACAGCCGG + Intergenic
986058490 5:4163540-4163562 GAGTTTGGTTGGTGCATGGATGG - Intergenic
986806338 5:11311950-11311972 GTGTGTGGGAGGTGTATATAGGG - Intronic
988167790 5:27616835-27616857 GAGAGTGGCTGATGTAGACAAGG - Intergenic
988312075 5:29572406-29572428 ATGTGTGACTGGTGTTTAGAAGG + Intergenic
989667020 5:43866485-43866507 TAGTTTGGCTGGAATATAGAGGG + Intergenic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
998032980 5:138889229-138889251 GAGTGTGGCAGCTGAAGAGAGGG + Intronic
998880248 5:146638148-146638170 TAGTGTGTCTGGTGTAGAAAGGG + Intronic
1001019842 5:168173576-168173598 GAGTGTGGCTGGTGTGGGGGAGG - Intronic
1002176067 5:177402225-177402247 GAGAGTGGCTGGGGCATGGAAGG - Exonic
1003478040 6:6503091-6503113 GCCTTTGGCTGGTGTATAAATGG - Intergenic
1004900827 6:20192405-20192427 GGGTGTGGGTGGTGTTTGGAAGG - Intronic
1005509803 6:26501927-26501949 GAAGGTGGCTGGTGAGTAGACGG + Exonic
1006688105 6:35854805-35854827 AAGTGTAGCTGGTTAATAGATGG - Intronic
1007247995 6:40476157-40476179 GAGTGTGGATGGGGCATGGAAGG - Intronic
1009624436 6:66121105-66121127 GTGTGTGGCTGGGGTAAAGGTGG + Intergenic
1009869586 6:69436706-69436728 GAGTGTGGCTGGTGGAGTGCAGG + Intergenic
1010254986 6:73747543-73747565 GAGAGTCATTGGTGTATAGATGG - Intronic
1011440297 6:87380258-87380280 GAGTGTGTCTGGTGAATGCAGGG + Intronic
1011622465 6:89255846-89255868 GAGTGTGGATGGTGTAACCAAGG + Intergenic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019057885 6:169236122-169236144 GAGTGTGGATGGTGTTTAAGGGG - Intronic
1019057902 6:169236200-169236222 GAGTGTGGATGGTGTTTATGGGG - Intronic
1019057949 6:169236404-169236426 GAGTGTGGATGGTGTTTATGGGG - Intronic
1019057958 6:169236448-169236470 GAGTGTGGATGGTGTTTACGGGG - Intronic
1019058004 6:169236695-169236717 GAGTGTGGATGGTGTTTATGGGG - Intronic
1022468661 7:30668263-30668285 GATTGGAGCTGGTGTATGGAGGG - Intronic
1023344786 7:39260267-39260289 GAGTGTGTGTGGTGTATGCATGG - Intronic
1023485012 7:40676925-40676947 GTGTGTGTGTGGTGTATAAAGGG + Intronic
1024225815 7:47326186-47326208 CAGAGTGCCTGGTGTATAGTAGG - Intronic
1026445294 7:70479429-70479451 GAGTGTGGCTGGTGTATTTCGGG - Intronic
1027048400 7:75006487-75006509 GGGGGTGGCTGGTGTATCCATGG - Intronic
1027163246 7:75817337-75817359 GAGTGAGGCTGGGGTAAATAGGG + Intronic
1027874751 7:83754736-83754758 TACTATGGCAGGTGTATAGAAGG - Intergenic
1028146638 7:87327225-87327247 GAGGATGGCTGGTTGATAGAGGG - Intergenic
1029384608 7:100235161-100235183 GGGGGTGGCTGGTGTATCCATGG + Intronic
1029685651 7:102146004-102146026 GAGTGTGGCTGGTGGAAAATGGG - Intronic
1029812731 7:103065736-103065758 GAGTGTGGCTGAGGTATAGTGGG + Intronic
1031137126 7:117897026-117897048 GAGTGCTACTGGTGTCTAGAGGG - Intergenic
1033296869 7:140146703-140146725 CAGTGAGGCTGTTCTATAGATGG - Intronic
1034596463 7:152198773-152198795 GAGCCTTTCTGGTGTATAGAAGG - Intronic
1034758163 7:153642468-153642490 GAGTGAGGCTAGTGTCTTGAAGG - Intergenic
1035158635 7:156934783-156934805 GAGGGTGGCTGGTGTGAAGGTGG - Intergenic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1043515196 8:80989645-80989667 GAGAGTGGCAGGTGGATAAAAGG - Intronic
1049348440 8:142151545-142151567 GAGTGTGGCTAATGTCCAGAGGG - Intergenic
1052377331 9:27732065-27732087 GAGTGTGGCAGGGGTATTGAAGG - Intergenic
1056705974 9:88953098-88953120 CAGAGTGGCTGGTGCATTGAAGG - Intergenic
1058553863 9:106144886-106144908 GAGTCTGGCTAGAGTATGGAGGG + Intergenic
1059378977 9:113908805-113908827 GAGGGTGGCTGGGGTATGAATGG - Intronic
1059708757 9:116848095-116848117 CAGTGTGTCTGGTGTATGGGGGG - Intronic
1059760696 9:117334610-117334632 CACTGTGGCTGGTGTGTAAAAGG - Intronic
1059874619 9:118620540-118620562 GAGTGTGGCTGGTGAAGACATGG - Intergenic
1060025499 9:120167459-120167481 GTGTGTGTCTGGTGTGTAGAAGG + Intergenic
1060557285 9:124514553-124514575 GAGTGTGGCTGGCTTAAAGTTGG - Intergenic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1186915999 X:14221685-14221707 GAGGTTGGGTGATGTATAGAAGG - Intergenic
1188770600 X:34148634-34148656 GAGAGTGGCTGGTGCATACCTGG + Intergenic
1194245620 X:91508381-91508403 AACTGTGGATGTTGTATAGATGG - Intergenic
1196589631 X:117471328-117471350 GGGTGTGGCTAGTGCATAGTGGG + Intergenic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197835014 X:130685174-130685196 GAGAGTGGCTGGTGTGTTCATGG + Intronic
1198212559 X:134529638-134529660 GAGTGTGGGTGGGGCATATAGGG - Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1200178999 X:154139093-154139115 GAGTGGGGTTGGTGAATAGGAGG - Intergenic
1200564588 Y:4749631-4749653 GACTGTGGATATTGTATAGATGG - Intergenic
1201383843 Y:13416661-13416683 GAGTGTGGCAGGTCTTCAGAAGG - Intronic