ID: 946188011

View in Genome Browser
Species Human (GRCh38)
Location 2:217992116-217992138
Sequence TAGGCCCCCCTGCCCCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946188011_946188023 30 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188023 2:217992169-217992191 TGCCCCAGGCACTCACCCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 349
946188011_946188021 28 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188011_946188017 16 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305
946188011_946188022 29 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188022 2:217992168-217992190 CTGCCCCAGGCACTCACCCTGGG 0: 1
1: 1
2: 4
3: 40
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946188011 Original CRISPR TAGGCCCCCCTGCCCCGCAG TGG (reversed) Intronic