ID: 946188011

View in Genome Browser
Species Human (GRCh38)
Location 2:217992116-217992138
Sequence TAGGCCCCCCTGCCCCGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946188011_946188017 16 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305
946188011_946188021 28 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188011_946188023 30 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188023 2:217992169-217992191 TGCCCCAGGCACTCACCCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 349
946188011_946188022 29 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188022 2:217992168-217992190 CTGCCCCAGGCACTCACCCTGGG 0: 1
1: 1
2: 4
3: 40
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946188011 Original CRISPR TAGGCCCCCCTGCCCCGCAG TGG (reversed) Intronic
900113613 1:1019782-1019804 CAGGCGCCCCTCCCCCGCCGCGG - Intergenic
900207942 1:1439557-1439579 TGCGCCTCCCCGCCCCGCAGCGG - Exonic
900521584 1:3107930-3107952 TCAGCCCCCCTCCCCGGCAGGGG - Intronic
901443545 1:9293327-9293349 CGGGACCCCCTGCCCTGCAGCGG - Intronic
901445687 1:9306595-9306617 TGGGCCTCCCTGCCACCCAGGGG + Intronic
903131736 1:21284018-21284040 TTGGCCACCCTGCCCTGGAGAGG - Intronic
904402734 1:30267310-30267332 CAGGCCCCCCAGCCCCTTAGAGG - Intergenic
906062551 1:42958240-42958262 TCGGGCCCCCTCCCCCGCACCGG + Intronic
906310840 1:44753142-44753164 TAGGCCTTCCTGCCCTGCAGTGG + Exonic
912408868 1:109466426-109466448 GAGTCCCCCCCGCCCCGCGGCGG + Intergenic
916288010 1:163132239-163132261 TAGGCCCCTTTGACCCACAGCGG - Intronic
917937555 1:179883132-179883154 AGGGCCACCCTGACCCGCAGCGG + Intronic
923161433 1:231317893-231317915 CAGGCCACCCTGGCCAGCAGAGG + Intergenic
923180931 1:231518920-231518942 AAGCCCCCACTGCCCCGCACAGG + Intergenic
923527928 1:234787718-234787740 CAGCTCCCCCTGCCACGCAGCGG + Intergenic
924382088 1:243474560-243474582 TAGGCCACCCTGCCCGGCGAGGG + Intronic
1064478839 10:15719821-15719843 CAGCCCCCCTTGCCCCGCAGGGG - Exonic
1066440567 10:35435039-35435061 AAAGCCCCCCTGCCTTGCAGAGG + Intronic
1069258623 10:66365378-66365400 TAGTCCCCCCAGCCCCTGAGAGG - Intronic
1069676578 10:70253107-70253129 TATGCCCTCCTGCCCCTCAGTGG - Exonic
1076725363 10:132410555-132410577 CACGCCCCCCTCCCCTGCAGTGG - Intronic
1077087935 11:763947-763969 GAGGCCCCACTGCCCAGCTGTGG + Intronic
1083324686 11:61867239-61867261 TATGCCCCCGACCCCCGCAGAGG + Exonic
1083766455 11:64843743-64843765 TAGGCCCCCCTCCCCGGCCCCGG + Intronic
1084279259 11:68076509-68076531 TATGCTCCCCTGCTCCCCAGGGG + Intronic
1084590605 11:70087941-70087963 GACGCCCCCTTGCCCGGCAGGGG - Exonic
1084652939 11:70499684-70499706 TAGGCCCCACTGCTGCGCCGAGG - Intronic
1086479220 11:87216189-87216211 TAGTCCCCCCTTATCCGCAGGGG - Intronic
1089603040 11:119626770-119626792 ATGTCTCCCCTGCCCCGCAGTGG - Intronic
1090068654 11:123525410-123525432 CAGGTTCCCCTCCCCCGCAGGGG + Intergenic
1091664529 12:2409823-2409845 CAGGGCCCGCTGCCCAGCAGGGG + Intronic
1091999305 12:5019470-5019492 AAGGCCCCCCTGCCCTCCAGAGG + Intergenic
1096595167 12:52690556-52690578 CACGCCCCCCTGCCCTGCTGGGG - Exonic
1101448003 12:104751750-104751772 TAGTACCACCTACCCCGCAGGGG - Intronic
1102505338 12:113381083-113381105 TAGACCCCCAGGCCCCGCACAGG + Intronic
1103861401 12:124017351-124017373 CAGGCCTCCCTGCCCCTTAGGGG - Intronic
1103999894 12:124853857-124853879 TAGGCCCCATTGCCCTGCACAGG + Intronic
1104912295 12:132245108-132245130 CAGGCTCCCCTGCCCCGCGGAGG + Intronic
1105446382 13:20461275-20461297 TAGCACCTCCTGCCCCACAGAGG + Intronic
1106370533 13:29128213-29128235 AAGGCCTGCCTGCCCAGCAGTGG - Intronic
1114069240 14:19094909-19094931 TGAGCCCTCCTGGCCCGCAGTGG - Intergenic
1114093019 14:19305093-19305115 TGAGCCCTCCTGGCCCGCAGTGG + Intergenic
1121414082 14:93767011-93767033 TAGGCCACTCTGCCCATCAGTGG - Intronic
1122043713 14:99008560-99008582 TAGGCCCCCCTGAGCTGCCGAGG + Intergenic
1122123994 14:99569427-99569449 CAGGCTGCCCTGCCCCACAGAGG + Intronic
1122534227 14:102451082-102451104 TAGGCAGACCTGCCCTGCAGCGG + Intronic
1122774427 14:104110898-104110920 TGGGCCCACCTGCCCTGGAGTGG - Intronic
1125834273 15:42736515-42736537 GAGGCCCCTCTGGCCCGCCGCGG - Exonic
1127259745 15:57319386-57319408 GACGCCCCGCCGCCCCGCAGGGG + Intergenic
1128799668 15:70489563-70489585 AAGGCCTCCATGCCCCTCAGAGG + Intergenic
1131121878 15:89827968-89827990 TGGGCTCCCCTGCCCTGGAGAGG - Intergenic
1132514165 16:358530-358552 TTTGGGCCCCTGCCCCGCAGCGG - Intergenic
1132686556 16:1164712-1164734 TTGGCCCTCAAGCCCCGCAGAGG + Intronic
1135970333 16:27067459-27067481 GAGGCCAGCCTGCCCGGCAGCGG + Intergenic
1136027013 16:27475080-27475102 CAGTCCTCCCTGCCCCGCTGTGG + Intronic
1137613770 16:49835400-49835422 TGGGCCCCACATCCCCGCAGAGG + Intronic
1137835104 16:51584200-51584222 TAGGGCACCTTGCCCTGCAGTGG + Intergenic
1137979062 16:53054790-53054812 TAGATCCCAGTGCCCCGCAGCGG + Intergenic
1139597800 16:67968395-67968417 CAGGCCCCGCTGCCCCGCCACGG + Intronic
1141689512 16:85588340-85588362 TGGCCCCCCCTTCCCCGCTGCGG + Intergenic
1142239185 16:88937419-88937441 TGGGACCCGCTGCCTCGCAGGGG - Intronic
1142969446 17:3601328-3601350 CAGGCCCCCTTGCCTCTCAGGGG + Intergenic
1144339390 17:14299745-14299767 GAGGCCCTCTGGCCCCGCAGAGG + Intergenic
1145103951 17:20099399-20099421 TAAGCCACCCTGCCCGGCCGAGG - Intronic
1145251281 17:21298223-21298245 GAGGCCCACCAGCCCTGCAGGGG - Intronic
1145811344 17:27765911-27765933 TGGGCCCCCCTCCTCCCCAGAGG - Intronic
1147184250 17:38705190-38705212 CCGGCCCCCCTGCCCGGCCGCGG - Intergenic
1148215158 17:45830269-45830291 GGGGCCCGCCTGCCCTGCAGAGG + Intronic
1150134489 17:62688546-62688568 TTGGCCTCCATGCCTCGCAGAGG + Exonic
1151724063 17:75874652-75874674 AAGGCCTCCCGGCCCCGCCGGGG - Exonic
1152120213 17:78413908-78413930 TGGCCCCCCCTGCCACACAGTGG + Intronic
1152239003 17:79151988-79152010 CAAGGCCCCCTGTCCCGCAGGGG + Intronic
1152473404 17:80502920-80502942 CAGGGCCACCTGCCCCACAGAGG + Intergenic
1152562702 17:81086582-81086604 TAGGCCCGCCACCCCCGCTGTGG + Intronic
1153329879 18:3862889-3862911 TGGGCCTCCCTGCCCCGCTTTGG + Intronic
1159825800 18:73208890-73208912 TAGCCCCCCCTTCCCCAGAGAGG + Intronic
1160159319 18:76459432-76459454 GAGGCCTCCCTGGCCGGCAGTGG - Intronic
1160273009 18:77404337-77404359 CAGGCCACCCTGCCGAGCAGAGG + Intergenic
1160790986 19:923681-923703 GATGCCCTCATGCCCCGCAGGGG - Intergenic
1160856510 19:1220320-1220342 GAGGCCTCCCTGCCCCTCACAGG - Intronic
1160872483 19:1283559-1283581 GTGGCCCCCCTGCCAGGCAGGGG + Intergenic
1160900996 19:1428573-1428595 TCGGTCCTGCTGCCCCGCAGTGG + Intronic
1161430532 19:4229628-4229650 TGGGCCCCCCAGTCCCCCAGGGG - Intronic
1162910033 19:13843400-13843422 CAGGCCCCCCTCCCCGGGAGGGG - Intergenic
1163329771 19:16628700-16628722 GCGGCCCCCCCGCCCCTCAGAGG + Intronic
1163509707 19:17727356-17727378 CCGGCCTCCCCGCCCCGCAGTGG - Exonic
1165779930 19:38426280-38426302 AAGGCCCCCCTCCCCCACACGGG + Exonic
1166064262 19:40347954-40347976 CAGGCCCCACTGCCGCACAGTGG + Intronic
1166373527 19:42314971-42314993 TAGGCCTCCCTACCCCCCACAGG + Exonic
1167550673 19:50158463-50158485 TAGGTCCCACTGCCCAGCAGAGG + Intronic
1167952429 19:53037973-53037995 TAGGCCCCCCCACTCCGCGGAGG - Intergenic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
927889984 2:26742237-26742259 TTGGCCTCCCTGCCAGGCAGGGG - Intergenic
927981496 2:27377664-27377686 CAGGCCCTCCTGCCCCACCGTGG + Exonic
937376337 2:121338389-121338411 CAGCCCGCCCAGCCCCGCAGTGG + Exonic
940503019 2:154518352-154518374 TAAGCCACCATGCCCGGCAGTGG + Intergenic
946188011 2:217992116-217992138 TAGGCCCCCCTGCCCCGCAGTGG - Intronic
946419602 2:219557511-219557533 CAGGGCCCCCTGGCCCGGAGAGG + Exonic
1169065840 20:2693658-2693680 CAGGACGCTCTGCCCCGCAGCGG + Exonic
1169144680 20:3244628-3244650 AAGGAGCCCCTGCCCTGCAGAGG + Intergenic
1171167709 20:22986552-22986574 TAGGCCCCCCTGCCCTCCCCCGG - Intergenic
1172037226 20:32018876-32018898 GAGACCCCCCCGCCCCGCCGAGG - Intronic
1175569706 20:60009558-60009580 GCTGCCTCCCTGCCCCGCAGAGG - Intronic
1176009964 20:62887907-62887929 TCTGCCCCTCTGCCCCGCAGTGG - Intronic
1176168656 20:63687422-63687444 CAGGACCCCCTGTCCCCCAGAGG + Intronic
1177804096 21:25856861-25856883 TAGTCCTCCCTGCCCTGCACAGG + Intergenic
1179226067 21:39454554-39454576 TTGTCCCCCCTGCCCCACTGTGG - Intronic
1179424138 21:41260070-41260092 TTGACCCCCCGGCCCCGCCGTGG + Intronic
1180158579 21:45989326-45989348 TAAGCCCCCCTGCCAGGGAGGGG + Intronic
1180487713 22:15817472-15817494 TGAGCCCTCCTGGCCCGCAGTGG - Intergenic
1181039349 22:20184509-20184531 CAGGCCCCCATGCACCGCACAGG + Intergenic
1181550008 22:23632478-23632500 GTGGCCCCCCTGCCCCTCTGTGG + Intergenic
1183169923 22:36180270-36180292 TTGGCCCCCCCGCCCCAGAGCGG - Intergenic
1183396056 22:37571547-37571569 TAGAGGCACCTGCCCCGCAGGGG + Intronic
1183526118 22:38323916-38323938 TAAGCCACCATGCCCCGCTGTGG + Intronic
1184656941 22:45946633-45946655 TAGGCCCCCCTCCACTGCTGTGG - Intronic
1184732030 22:46375980-46376002 AAGGCCACCCTGCACCACAGTGG + Intronic
1185277865 22:49957538-49957560 CAGCCGCCCCTGCTCCGCAGTGG - Intergenic
953884105 3:46705954-46705976 CAGCACCCCCTGCCCCCCAGAGG + Intronic
961465021 3:127076373-127076395 TGAGCCTCCCTGCCCCGCCGTGG - Intergenic
961684136 3:128617834-128617856 GAGGCCCGCCGGCCCAGCAGAGG + Intergenic
962448753 3:135493730-135493752 TAGCCCACCCTGCCTCCCAGTGG + Intergenic
969850563 4:9953377-9953399 TGGGCCCACCTGGCCCTCAGTGG - Intronic
973274182 4:48291567-48291589 TGAGCCACCCTGCCCAGCAGAGG + Intergenic
976431177 4:84965815-84965837 TAGGCGGCCCTGGCTCGCAGGGG - Intronic
978222946 4:106298964-106298986 TAGGCCCCCCTTTTCCTCAGGGG - Intronic
982072673 4:151709228-151709250 TAGGCCCCACAGCCCAGCACTGG - Intronic
997962773 5:138335215-138335237 TCAGCCCCTCTGCCCTGCAGAGG - Intronic
999254955 5:150205008-150205030 AGGGCCACCCTGGCCCGCAGTGG + Intronic
1001263393 5:170253124-170253146 TCGGCCCCCATCCCCCGCGGAGG - Exonic
1001589905 5:172858163-172858185 TGGGCCTCCCTGCCTCTCAGTGG - Intronic
1002194354 5:177494284-177494306 TGGGCCCCCATGCTCAGCAGAGG - Intronic
1002498510 5:179632364-179632386 TAGCACCCCCTCCCCCGCCGCGG + Intronic
1003895340 6:10602283-10602305 TAGGACCCCCTACCCCACAAGGG + Intronic
1007582028 6:42965500-42965522 TAGGCCCCCATTCTCCTCAGTGG + Intronic
1007786246 6:44281166-44281188 TAGCCCACCCAGCCCAGCAGGGG - Intronic
1008133142 6:47740640-47740662 TAAGCCCCACTGCCCCGCAGAGG - Intergenic
1013998989 6:116343167-116343189 TAGGCCTCCTTGACCTGCAGTGG - Intronic
1015842075 6:137487722-137487744 GAGGCCCCCCTCCCCAGCTGCGG - Intergenic
1018741726 6:166734147-166734169 TCGGCCCCCTTGCCCCTCAGGGG - Intronic
1018996271 6:168712669-168712691 TGGGCCTCCATGCCCTGCAGTGG + Intergenic
1019474391 7:1236872-1236894 TCGGCCTCCCAGCCCCGCCGAGG + Exonic
1019842505 7:3462327-3462349 TCTTCCCCCCTGCCCCGCCGAGG + Intronic
1023995237 7:45155758-45155780 TAAACCCACCTGCCCTGCAGAGG + Intergenic
1026408870 7:70098404-70098426 TAGGACTCCCAGCCCCGCAAGGG - Intronic
1028596026 7:92547029-92547051 AAGGCCCCCCTTCCCCCCACAGG + Intergenic
1029424968 7:100489346-100489368 TAGGCCCCCTGACCCCGCTGTGG + Exonic
1031656256 7:124360137-124360159 TGGGCCACCCAGCCCCACAGAGG + Intergenic
1035018648 7:155787680-155787702 GAGGCTCTCCTGCCCCGCGGAGG + Intergenic
1041552503 8:59118372-59118394 GAGGCGCCCCTGCCCCCCACAGG - Intronic
1047527514 8:125646160-125646182 AAAGCCTCCCTGCCCTGCAGAGG - Intergenic
1048214209 8:132480700-132480722 TGGCCTCCCCTGCCCCCCAGGGG - Exonic
1049409075 8:142464460-142464482 AAGGCGCCCGTGCCCTGCAGCGG + Exonic
1049613787 8:143567702-143567724 CAGGCCCCACAGCCCCCCAGGGG + Intronic
1054788238 9:69230186-69230208 AAGGCCCTCCTGCTCCGCCGAGG - Exonic
1059354827 9:113690507-113690529 CAGGCATCCCTGCCCCGCAGTGG - Intergenic
1060114373 9:120928913-120928935 CGGGCGCCCCGGCCCCGCAGGGG - Intronic
1061154160 9:128847065-128847087 CAGGCCCCCCTGTCCTGGAGGGG + Intronic
1061431415 9:130533642-130533664 TGGTCCCTCCTGCCCCTCAGGGG + Intergenic
1061519974 9:131112082-131112104 TCTGCCCCCCTGCCCCACTGCGG - Intronic
1061808542 9:133149378-133149400 CAGGCCCGGCTGCCCCGCGGGGG - Intergenic
1062186287 9:135220373-135220395 TACTGCCCCCTTCCCCGCAGAGG - Intergenic
1062276913 9:135735643-135735665 TAGGCCCACCTGCCTCCCACAGG + Intronic
1062332565 9:136051116-136051138 CTGGCCCGCCTTCCCCGCAGGGG - Intronic
1062587254 9:137254964-137254986 CCCGCCCCTCTGCCCCGCAGGGG - Intergenic
1187517987 X:19990425-19990447 GAGGCGCTCCTGCCGCGCAGCGG - Intergenic
1189986207 X:46555652-46555674 TGGGCCCCCATGCCCAGCAAGGG + Intergenic
1200212781 X:154354289-154354311 TCAGCCCCACTGCCCCACAGGGG - Exonic