ID: 946188017

View in Genome Browser
Species Human (GRCh38)
Location 2:217992155-217992177
Sequence CAGAAAGCATCCCCTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 305}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946188003_946188017 27 Left 946188003 2:217992105-217992127 CCTTTTGGGCCCCACTGCGGGGC 0: 1
1: 0
2: 1
3: 6
4: 97
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305
946188011_946188017 16 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305
946187999_946188017 30 Left 946187999 2:217992102-217992124 CCACCTTTTGGGCCCCACTGCGG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305
946188010_946188017 17 Left 946188010 2:217992115-217992137 CCCACTGCGGGGCAGGGGGGCCT 0: 1
1: 0
2: 1
3: 13
4: 203
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305
946188013_946188017 -3 Left 946188013 2:217992135-217992157 CCTATTCAGAGGACTCCCCACAG 0: 1
1: 0
2: 1
3: 28
4: 253
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305
946188009_946188017 18 Left 946188009 2:217992114-217992136 CCCCACTGCGGGGCAGGGGGGCC 0: 1
1: 0
2: 3
3: 21
4: 297
Right 946188017 2:217992155-217992177 CAGAAAGCATCCCCTGCCCCAGG 0: 1
1: 0
2: 3
3: 36
4: 305

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946188017 Original CRISPR CAGAAAGCATCCCCTGCCCC AGG Intronic