ID: 946188021

View in Genome Browser
Species Human (GRCh38)
Location 2:217992167-217992189
Sequence CCTGCCCCAGGCACTCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 586
Summary {0: 1, 1: 1, 2: 6, 3: 65, 4: 513}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946188011_946188021 28 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188015_946188021 -7 Left 946188015 2:217992151-217992173 CCCACAGAAAGCATCCCCTGCCC 0: 1
1: 0
2: 1
3: 20
4: 292
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188013_946188021 9 Left 946188013 2:217992135-217992157 CCTATTCAGAGGACTCCCCACAG 0: 1
1: 0
2: 1
3: 28
4: 253
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188009_946188021 30 Left 946188009 2:217992114-217992136 CCCCACTGCGGGGCAGGGGGGCC 0: 1
1: 0
2: 3
3: 21
4: 297
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188010_946188021 29 Left 946188010 2:217992115-217992137 CCCACTGCGGGGCAGGGGGGCCT 0: 1
1: 0
2: 1
3: 13
4: 203
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188014_946188021 -6 Left 946188014 2:217992150-217992172 CCCCACAGAAAGCATCCCCTGCC 0: 1
1: 0
2: 4
3: 23
4: 261
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513
946188016_946188021 -8 Left 946188016 2:217992152-217992174 CCACAGAAAGCATCCCCTGCCCC 0: 1
1: 0
2: 3
3: 54
4: 399
Right 946188021 2:217992167-217992189 CCTGCCCCAGGCACTCACCCTGG 0: 1
1: 1
2: 6
3: 65
4: 513

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946188021 Original CRISPR CCTGCCCCAGGCACTCACCC TGG Intronic