ID: 946188023

View in Genome Browser
Species Human (GRCh38)
Location 2:217992169-217992191
Sequence TGCCCCAGGCACTCACCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 349}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946188014_946188023 -4 Left 946188014 2:217992150-217992172 CCCCACAGAAAGCATCCCCTGCC 0: 1
1: 0
2: 4
3: 23
4: 261
Right 946188023 2:217992169-217992191 TGCCCCAGGCACTCACCCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 349
946188016_946188023 -6 Left 946188016 2:217992152-217992174 CCACAGAAAGCATCCCCTGCCCC 0: 1
1: 0
2: 3
3: 54
4: 399
Right 946188023 2:217992169-217992191 TGCCCCAGGCACTCACCCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 349
946188011_946188023 30 Left 946188011 2:217992116-217992138 CCACTGCGGGGCAGGGGGGCCTA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 946188023 2:217992169-217992191 TGCCCCAGGCACTCACCCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 349
946188013_946188023 11 Left 946188013 2:217992135-217992157 CCTATTCAGAGGACTCCCCACAG 0: 1
1: 0
2: 1
3: 28
4: 253
Right 946188023 2:217992169-217992191 TGCCCCAGGCACTCACCCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 349
946188015_946188023 -5 Left 946188015 2:217992151-217992173 CCCACAGAAAGCATCCCCTGCCC 0: 1
1: 0
2: 1
3: 20
4: 292
Right 946188023 2:217992169-217992191 TGCCCCAGGCACTCACCCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946188023 Original CRISPR TGCCCCAGGCACTCACCCTG GGG Intronic