ID: 946189923

View in Genome Browser
Species Human (GRCh38)
Location 2:218002755-218002777
Sequence CAGCAAAAGGATAAGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 318}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946189906_946189923 16 Left 946189906 2:218002716-218002738 CCCCTCCTTCAAGACTGACACCC 0: 1
1: 0
2: 3
3: 17
4: 174
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189914_946189923 -6 Left 946189914 2:218002738-218002760 CCCCGACCCCGGGCTCTCAGCAA 0: 1
1: 0
2: 0
3: 19
4: 766
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189908_946189923 14 Left 946189908 2:218002718-218002740 CCTCCTTCAAGACTGACACCCCC 0: 1
1: 0
2: 1
3: 9
4: 148
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189907_946189923 15 Left 946189907 2:218002717-218002739 CCCTCCTTCAAGACTGACACCCC 0: 1
1: 0
2: 1
3: 12
4: 155
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189912_946189923 -4 Left 946189912 2:218002736-218002758 CCCCCCGACCCCGGGCTCTCAGC 0: 1
1: 0
2: 4
3: 15
4: 278
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189915_946189923 -7 Left 946189915 2:218002739-218002761 CCCGACCCCGGGCTCTCAGCAAA 0: 1
1: 0
2: 0
3: 17
4: 142
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189916_946189923 -8 Left 946189916 2:218002740-218002762 CCGACCCCGGGCTCTCAGCAAAA 0: 1
1: 0
2: 0
3: 12
4: 740
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189909_946189923 11 Left 946189909 2:218002721-218002743 CCTTCAAGACTGACACCCCCCGA 0: 1
1: 0
2: 0
3: 0
4: 68
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318
946189913_946189923 -5 Left 946189913 2:218002737-218002759 CCCCCGACCCCGGGCTCTCAGCA 0: 1
1: 0
2: 0
3: 38
4: 834
Right 946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG 0: 1
1: 0
2: 3
3: 23
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946189923 Original CRISPR CAGCAAAAGGATAAGGTGGC AGG Intronic
900559175 1:3295222-3295244 CAGGAAAGGCATCAGGTGGCGGG + Intronic
901057044 1:6453414-6453436 CAGCCCACGTATAAGGTGGCCGG - Intronic
901451682 1:9339931-9339953 CATCAGAAGGAAAAGGTGGAGGG - Intronic
901572008 1:10168595-10168617 TAGAAAAAGCATAAGGTGCCGGG + Intronic
902477330 1:16695079-16695101 CAGCCCACGTATAAGGTGGCCGG + Intergenic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902735320 1:18396936-18396958 CAGCAAGAGGAAAAGGTGATAGG - Intergenic
903791742 1:25897976-25897998 CAGCACAGGGATGAGGTGGGAGG - Intronic
905007932 1:34725996-34726018 CAGTGAAAGTATAAGGTGGTTGG - Intronic
906042297 1:42797275-42797297 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
908835436 1:68224761-68224783 AAGCAAAACGAAAAGGTGGGGGG + Intronic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
911591460 1:99752897-99752919 CAGGAACAGGACAAGGGGGCTGG + Intronic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
916729089 1:167550482-167550504 AAGCTTAAGGATGAGGTGGCAGG + Intronic
919616842 1:199818561-199818583 CAGCAAGAGGACAAGATGGAGGG + Intergenic
919927690 1:202200825-202200847 CAGCAAAAGGACATGGTGGGGGG + Intronic
920430764 1:205917421-205917443 CAGGAAAAGGGACAGGTGGCCGG + Intronic
920798165 1:209160715-209160737 CAGCAAAATGAAAAGATGGTAGG - Intergenic
920833368 1:209485329-209485351 CAGCAAGAGGATAAAATTGCTGG + Intergenic
920885731 1:209926077-209926099 CAACAAAAGCATTAGGTGGATGG - Intergenic
921048746 1:211495854-211495876 CAGCAAAGGGGAAAGGTGGAAGG - Intergenic
921310546 1:213838734-213838756 CAGGCAAAGGCTAAGCTGGCAGG + Intergenic
921506126 1:215972469-215972491 GAACAAAAGGGAAAGGTGGCAGG - Intronic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
924826286 1:247542398-247542420 CAGCATATGGAAAAGGTGGAAGG + Intronic
1062897069 10:1111602-1111624 CATCAAAAGGAAAAGGTGACTGG - Intronic
1066221704 10:33341305-33341327 CAGCAAAATTATAAAGTGACAGG + Intergenic
1066956307 10:42177154-42177176 CAGCAAAAAGCCACGGTGGCGGG - Intergenic
1067932003 10:50571452-50571474 CAGGAAATGGAAAAGGTGCCAGG - Intronic
1068340913 10:55701167-55701189 AACCAAAATGATAGGGTGGCAGG + Intergenic
1069433893 10:68362493-68362515 GAACAAAAGGAAAATGTGGCTGG + Intronic
1069998621 10:72359301-72359323 AAGCAAAAGGAAACAGTGGCCGG - Intergenic
1070340303 10:75492189-75492211 CAGCAAAAGGGTCAGTTGGCTGG - Intronic
1071987522 10:91067382-91067404 CAGCAAGAGGCCAATGTGGCTGG + Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075363546 10:121862212-121862234 CAGTAAAGGGATGAGGTGGTCGG - Intronic
1075485675 10:122820296-122820318 CTGCAAGAGGATAATGTAGCTGG - Intergenic
1077114813 11:879231-879253 AAGAAAAAGAATAAGGTGGGTGG - Intronic
1077755641 11:5025047-5025069 CAGCACTAGCATAGGGTGGCTGG - Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1078562846 11:12388153-12388175 CACCAAGAGGAGAAGATGGCTGG + Intronic
1079902077 11:26199227-26199249 CTGCAAAAGGATATGGAGTCAGG - Intergenic
1080417564 11:32083158-32083180 CGGCAAAAGGATAAGGAAGTAGG - Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081912051 11:46705859-46705881 CAGCAAAAGGCAAAGCTGTCAGG - Exonic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083284249 11:61647767-61647789 CAGCAAAAGCATAAGGAACCAGG - Intergenic
1084137866 11:67200619-67200641 CAGCTAAAGGCTGAGGTGGAAGG - Intronic
1084564362 11:69920861-69920883 CATCAATAGGGTAATGTGGCGGG + Intergenic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1084705162 11:70811856-70811878 CAGAAAAATGATAAGATGGATGG - Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1086428724 11:86714717-86714739 CAGCAAAATGATAAGCCTGCTGG + Intergenic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1086652351 11:89308234-89308256 CAGCAAAGGGATAAAGTGTGTGG + Intergenic
1088021133 11:105120982-105121004 CAGTCAAAGGATAAGATGACAGG - Intergenic
1089612159 11:119675389-119675411 CAGCAAAAGGCTAGGGGGCCTGG - Intronic
1089845292 11:121453505-121453527 CAGCAAAAGTATAAGGTCGGTGG + Intronic
1090350684 11:126105885-126105907 CAGCCGAAGGATAGGGTGCCTGG - Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1091866761 12:3845135-3845157 CACCAAAGGGAAAAGGGGGCTGG - Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092966689 12:13650539-13650561 CAGCAGAAAGAAAGGGTGGCTGG - Intronic
1094169220 12:27474436-27474458 CATAAAAAAGAAAAGGTGGCAGG - Intronic
1094360038 12:29620796-29620818 CAGCACAGGAAAAAGGTGGCAGG + Intronic
1094477273 12:30850881-30850903 CATTAAAAGGATAAGGTGGGAGG + Intergenic
1097971153 12:65634373-65634395 CAGCAAAAGGAAAAGGTGCATGG - Intergenic
1099335567 12:81352339-81352361 CAGGAAAAGGGAAAGGTGGGTGG + Intronic
1101875116 12:108592342-108592364 CAACAGAAGGATGAGGAGGCTGG + Exonic
1102780854 12:115563329-115563351 CAGGAAAAGGATGAGGTGGCGGG - Intergenic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103747715 12:123137279-123137301 CAGCTCCAGGAAAAGGTGGCAGG - Intronic
1104907284 12:132220095-132220117 CAGCAAAATGACAAGGCAGCTGG + Intronic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105477091 13:20737722-20737744 CAGCTGTAGGAGAAGGTGGCAGG - Exonic
1108590756 13:51911090-51911112 CACCAAAGTGATAAGGTGGCAGG - Intergenic
1111823271 13:93238949-93238971 CAACAAAAGGATAATTTGCCAGG - Intronic
1113904634 13:113813471-113813493 GAGAAAAAAGATAAGGTGGAGGG + Exonic
1116253544 14:42518574-42518596 CAGCAATTGGATAAAGTTGCAGG - Intergenic
1116369523 14:44111312-44111334 CCTCAAGAGGATAAGGTGGAAGG - Intergenic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1117122196 14:52580068-52580090 CAGAAAAAGGTTAACATGGCAGG - Intronic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117770692 14:59131247-59131269 CATCAAAAGCAGTAGGTGGCAGG - Intergenic
1119167287 14:72505070-72505092 CAGCAAAAGCCTAAATTGGCTGG - Intronic
1120819355 14:88897718-88897740 CAGAAAATGGATTAGGTGGGGGG - Intergenic
1120940076 14:89939488-89939510 CAGCAACAGGAGCAGGAGGCGGG + Intronic
1121160451 14:91734425-91734447 CATAAAAAGGATAAGAAGGCTGG - Intronic
1121479348 14:94249865-94249887 CAGCTAAAAGAATAGGTGGCAGG + Intronic
1122095958 14:99372381-99372403 CAACAAAAAGCTAAGGTGGCTGG - Intergenic
1125052774 15:35320713-35320735 AAGAAATAGGATAAGGTGGATGG - Intronic
1126079581 15:44946384-44946406 CAGCAGAAGGCTAAGGAGGAAGG + Intergenic
1126936504 15:53714973-53714995 CAGCAAAAGGTTAAGATGAGGGG - Intronic
1128914957 15:71551589-71551611 CAACAAAAGGAAAAGGTTCCTGG + Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1130079496 15:80720094-80720116 CAACAAAAAGAAAAGGAGGCTGG - Intronic
1130374451 15:83315976-83315998 CAGAAAAAATATAAGGTAGCTGG - Intergenic
1130554928 15:84915915-84915937 CAACAACAGGTTGAGGTGGCTGG - Intronic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1130801037 15:87263509-87263531 TAGCAAAAAGACCAGGTGGCTGG - Intergenic
1133388894 16:5393153-5393175 CAGAGAAAGGATGAGGGGGCAGG - Intergenic
1133465756 16:6025534-6025556 CATCAAAAGGATGTGGTGGTGGG - Intronic
1138319403 16:56099056-56099078 CAGCAAAAAGAGAAGGAGGTGGG + Intergenic
1138472655 16:57250412-57250434 CACCATAAGGATGAAGTGGCTGG + Exonic
1139396009 16:66639772-66639794 CATCAAAAGGCTGAGGTGGGTGG + Intronic
1139840348 16:69873525-69873547 CAGCACAAGGATACAGTGGGTGG - Intronic
1140025077 16:71280832-71280854 CAATAAAAGAATAAGGGGGCAGG + Intergenic
1140670363 16:77271722-77271744 TATCAACAGGATAAAGTGGCAGG - Intronic
1140809572 16:78564483-78564505 CCTCACAAGGATCAGGTGGCAGG + Intronic
1140882043 16:79207226-79207248 GAGTCAATGGATAAGGTGGCTGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141357193 16:83358299-83358321 CAGCAAAAGAAATAGGTGGTAGG - Intronic
1142619516 17:1155967-1155989 AAAAAAAAGGATAGGGTGGCAGG + Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1147057221 17:37843977-37843999 CACCTAGAGGATAAGGTGTCAGG - Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1148121295 17:45213587-45213609 CAAAAAAATGAAAAGGTGGCTGG - Intergenic
1148458210 17:47822154-47822176 CAGCAAAAGTATCAGGTTGATGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149570181 17:57666795-57666817 CAGCAACATGAGAGGGTGGCTGG + Intronic
1150631098 17:66881033-66881055 CAGCAAAAGTCCAGGGTGGCTGG - Intronic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1155081856 18:22418356-22418378 CACCAAAGGGATAAGGGGGCAGG - Intergenic
1155096517 18:22560685-22560707 CAGCCAAAGGAGAAAGTGGAGGG - Intergenic
1155930024 18:31697307-31697329 CAGCAAATGGAGAAGATGGCAGG + Intergenic
1156945420 18:42823866-42823888 CAGGAAAAGGATAAGATGATAGG - Intronic
1159549883 18:69883947-69883969 CAGCAAAGGGATAAACTGCCTGG + Intronic
1159738710 18:72137416-72137438 CAACAAAAGAATTAGGGGGCAGG - Intergenic
1159862377 18:73664098-73664120 CAGCAAAAGAAAAAAGTGGCCGG + Intergenic
1160057977 18:75503900-75503922 CATCAAAAAGCAAAGGTGGCAGG - Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1162564669 19:11438861-11438883 CTACAAAAGGATCAGCTGGCAGG - Intronic
1163499102 19:17664902-17664924 AAGCAAATGGAAAAGGTGCCAGG + Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1164725586 19:30463745-30463767 CACCAAAAGTCTACGGTGGCAGG - Intronic
1165379001 19:35464556-35464578 GAGCAAAAGGAAAAGGGGGTGGG + Intergenic
1165680186 19:37767572-37767594 CAGCAAAGCGAGAAGATGGCAGG - Intronic
1165895718 19:39139708-39139730 CAGCCAAAGGATAAGGAGATTGG - Intronic
1166395053 19:42433530-42433552 CAGGAAAAGGATAAGGGGCAGGG + Intronic
1166521492 19:43483382-43483404 CGGGAAAAGGCTAAGGTGGGAGG - Intronic
1167836816 19:52079620-52079642 CAGCAAAGAGAAAAGGTGGGAGG + Intronic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
1202711346 1_KI270714v1_random:20905-20927 CAGCCCACGTATAAGGTGGCCGG + Intergenic
926969451 2:18452286-18452308 TAGCAACAGAATGAGGTGGCAGG - Intergenic
927076861 2:19587314-19587336 CAGGAAAATGATAAGGTTCCAGG + Intergenic
928622565 2:33105719-33105741 CAGCAAAAAGATTATGGGGCTGG - Intronic
928893144 2:36229337-36229359 AAGTCAAAGAATAAGGTGGCAGG + Intergenic
929169414 2:38916707-38916729 AAGCAAAATAATAAGTTGGCAGG - Intronic
931719747 2:65058465-65058487 CAGCCATCGGATAAGGTGTCAGG - Intronic
933883162 2:86692219-86692241 TATAAAAAGGATAATGTGGCTGG + Intronic
935151222 2:100438360-100438382 CAATAAAAGGATGAGGTGGAAGG - Intergenic
935314329 2:101816630-101816652 GAGCAAAAGGAGAAGGTAGGTGG - Intronic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936836250 2:116712720-116712742 CAGCAAAAGGGTCATGGGGCAGG + Intergenic
937217088 2:120319601-120319623 CAGCACAAGGTGAAGCTGGCTGG + Intergenic
937463626 2:122110478-122110500 CAGGAAAAGGATAGGGGAGCTGG + Intergenic
940526719 2:154825165-154825187 CAGGAAAAGGGTAAGTTGGGAGG - Intronic
941047097 2:160688933-160688955 CAGCACAAGGATCAGGGGGCTGG - Intergenic
942993527 2:182232229-182232251 AAGCAAAATCATGAGGTGGCTGG - Intronic
943276703 2:185876513-185876535 CAGCAAAATGCTCAGGTGGTGGG - Intergenic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946363697 2:219235486-219235508 CCGCAACAGTATAAGGTGGCCGG - Exonic
946598715 2:221335476-221335498 CAGCATAAGGAGACGGTAGCCGG - Intergenic
947229760 2:227872839-227872861 CAGCCAAAGGGAATGGTGGCTGG - Intronic
947520470 2:230841986-230842008 ATACAAAAGGTTAAGGTGGCTGG - Intergenic
948276027 2:236709505-236709527 GAGAAATAGGACAAGGTGGCTGG + Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948987366 2:241533552-241533574 CAGCAAGAGGGAGAGGTGGCAGG - Intergenic
1169010704 20:2247701-2247723 CAGCAAAGGGAAAAGGTGCATGG + Intergenic
1169380874 20:5106175-5106197 CAGCAAAGGGGTAAGCTGACGGG - Exonic
1169593764 20:7175293-7175315 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
1170462065 20:16586677-16586699 CAGCCAAAGGAGAAGGTGAAGGG + Intergenic
1172147120 20:32764481-32764503 CAGGAAAAGGAGAGGCTGGCAGG - Intronic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174696582 20:52565604-52565626 CAGTACAAGGGTGAGGTGGCTGG + Intergenic
1175788734 20:61728294-61728316 TAGCAAAAGCATAGGGTGGAAGG + Intronic
1177796302 21:25782072-25782094 CAGCGAAAGGCTGAGGTGGGAGG - Intergenic
1177893145 21:26831488-26831510 CAGCAAGAGGCCAATGTGGCTGG - Intergenic
1178073320 21:28992927-28992949 CAGCAAATGGACAGGGTGGGTGG - Exonic
1178123793 21:29496033-29496055 CAGGAAAAGGATAAGAAGGAAGG - Intronic
1178412120 21:32373328-32373350 AAGCAAGAGGAAAAGATGGCCGG + Intronic
1178671232 21:34593516-34593538 CAGTAAATGCAAAAGGTGGCAGG - Intronic
1178676480 21:34635547-34635569 CACCCAAAGGGTAAGGAGGCAGG + Intergenic
1178738028 21:35170491-35170513 CATCACAAGGCTAAGTTGGCAGG + Intronic
1180031379 21:45210818-45210840 CAGGAAAAGGAGGAGCTGGCAGG + Intronic
1181891738 22:26069300-26069322 CGGCAATAGGAGAAGGTGACAGG + Intergenic
1181990572 22:26833779-26833801 CAGGCAAAAGATAAGGTGCCTGG + Intergenic
1182160203 22:28114020-28114042 CTGGAAAAGGATATGGAGGCTGG - Intronic
1182511611 22:30824201-30824223 CAACAGAAGGATAAGATGGAAGG - Intronic
1182723755 22:32426240-32426262 CAGGAAAAGGATCAAGTGGGTGG - Intronic
1183312203 22:37116442-37116464 CATAAAAAGGATAAGGAGTCTGG + Intergenic
1184051540 22:42009157-42009179 CAGCACAAGGCCAAGGTGGGTGG - Intronic
1184420664 22:44381175-44381197 CAGCAAATGGATCTGGGGGCTGG - Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949310347 3:2690301-2690323 CATCAAGAGGCAAAGGTGGCTGG + Intronic
950051272 3:9991674-9991696 CTGCAAAAGGATAATCAGGCTGG - Intronic
950225470 3:11230080-11230102 GAACAAAAGGAGTAGGTGGCTGG + Intronic
950300082 3:11869252-11869274 CTGCAAAAGGATAATCAGGCTGG - Intergenic
950344719 3:12282630-12282652 CAGCACTAGGCCAAGGTGGCCGG - Intergenic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
953334626 3:42083759-42083781 CAGCTACAGGCTAAGGTGGGAGG + Intronic
953604746 3:44404433-44404455 CAGAAAAAGGCTAAGGAAGCAGG - Intronic
954213380 3:49110915-49110937 CAGCAAGTAGATAAGGGGGCAGG - Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
956146957 3:66199818-66199840 CTGCATAAGGATCAGGTGTCAGG - Intronic
957255281 3:77827923-77827945 CAGCAAAAGGAAAAGGTGTGTGG + Intergenic
957318553 3:78599701-78599723 CAGCACCAGGGTAATGTGGCTGG - Intronic
958897088 3:99841375-99841397 CGGCAAAAGGCAAAGGTGGTTGG - Intronic
959684630 3:109130958-109130980 CAGCAAAGGGATATGGAGGAAGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960333240 3:116388287-116388309 CACCCAAAGGAAAAGGTGGAGGG + Intronic
966109446 3:176380928-176380950 CAGCAGAAAGATAAAGTAGCTGG + Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966365239 3:179178736-179178758 CAGCAAAGGGAAAAGGTGAATGG + Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968183029 3:196611245-196611267 CAGCCAAAGGATTAGGTGTTGGG + Intergenic
971878019 4:32329152-32329174 CATCAAAAGGAAAAGGTGTATGG + Intergenic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973280042 4:48350354-48350376 TAGCAGAAGGGTAAGGAGGCAGG - Intronic
977529341 4:98181894-98181916 CAGCAAAAGGAAAATGTGCATGG + Intergenic
979736826 4:124096920-124096942 CAAGAAAGGGGTAAGGTGGCAGG - Intergenic
980145126 4:128973408-128973430 GGGCAAAAGGAAAAGGTGGGGGG + Intronic
980591097 4:134890649-134890671 CAGCAGAAGGAAAAGGTGCATGG + Intergenic
981400505 4:144308544-144308566 CAGCAAAAGGAACAGTTAGCAGG - Intergenic
981471001 4:145134778-145134800 CACCAAAGGGAAAAGGGGGCTGG + Exonic
982362129 4:154530347-154530369 CAGCATTAGGATAATGTAGCAGG - Intergenic
982495976 4:156092441-156092463 GAGAAAAAGGATATGGTGTCAGG + Intergenic
982512034 4:156294808-156294830 CAGCAAAAGGAAAACATGGAAGG + Intergenic
983570681 4:169204844-169204866 CTTCAAAAGGAGAAGGTGGCCGG - Intronic
984552595 4:181179088-181179110 CAGCAAGACGATAAGGAGACTGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
987503679 5:18744318-18744340 CAGGAAGAGGATATTGTGGCCGG + Intergenic
988516311 5:31907786-31907808 TAAGAAAAGGATCAGGTGGCTGG + Intronic
989040079 5:37218468-37218490 CAGCAAAGGGAAAAGGTGCATGG - Intronic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990253871 5:53944678-53944700 AAGGAAAAGGATAAGGTAGTAGG - Intronic
992509547 5:77419441-77419463 CATCAAAACAGTAAGGTGGCAGG - Intronic
992595706 5:78345345-78345367 CATCAAGAGGAGAAGGTGGAGGG - Intergenic
994453717 5:99978461-99978483 CAACACTAGGATAAAGTGGCGGG + Intergenic
996127771 5:119746024-119746046 CAGCAAAAGCATGAGAAGGCAGG - Intergenic
996891773 5:128428960-128428982 CAGCATGAGGATAAGCTGTCAGG - Intronic
997063040 5:130529690-130529712 CACCATAAGGATGAAGTGGCTGG + Intergenic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997650409 5:135513436-135513458 AAGAAAAAGGATATAGTGGCTGG - Intergenic
999363595 5:151006724-151006746 GGGCAAAAGGATAGGGTGGAGGG - Intergenic
999364775 5:151015217-151015239 CAGCAAAGGGAAAAGGTGCATGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
1000304085 5:159980085-159980107 CAGCAAAAGAGAAAGGTGGAAGG + Intergenic
1002774492 6:317303-317325 CAGCAAGAGGAACACGTGGCAGG - Intronic
1003659010 6:8043015-8043037 CAGCAAAGGGAAAAGGTGCTTGG - Intronic
1004375802 6:15089832-15089854 AAGCAGAAGGACAGGGTGGCAGG + Intergenic
1005045781 6:21640954-21640976 CAAAAAAAGGAAAAGATGGCCGG - Intergenic
1005446562 6:25930112-25930134 CAGGAAAAGGAGAACATGGCCGG - Intronic
1006693134 6:35907840-35907862 CAGCAGAGGGATGAGGTGGGAGG + Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1013124833 6:107172827-107172849 CAGAAATAGGATAGAGTGGCTGG + Intronic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014370914 6:120606563-120606585 CAGGAATAGCATTAGGTGGCTGG + Intergenic
1015652177 6:135475764-135475786 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017382787 6:153849499-153849521 CTGCAAAAGGATATGGCAGCAGG + Intergenic
1017547310 6:155466503-155466525 AAGCAACATGATATGGTGGCTGG - Intergenic
1017866653 6:158449781-158449803 CTGCTAGAGGTTAAGGTGGCTGG - Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018897069 6:168027154-168027176 TAGAAAAAGGGAAAGGTGGCCGG + Intronic
1018938378 6:168289767-168289789 CACCAAAGTGATAAGGGGGCAGG - Intergenic
1019209801 6:170395626-170395648 CAGCAAAAGCACAAGGTGAGAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020835082 7:13139113-13139135 CAGGAAAAGGTTAATGTGGTAGG - Intergenic
1022220812 7:28311829-28311851 CAGCAAAAGCGTCACGTGGCAGG + Intronic
1022469943 7:30675945-30675967 GAGCAAGACGATCAGGTGGCTGG + Intronic
1022981780 7:35611148-35611170 CAGCAGGAGGGTAGGGTGGCTGG + Intergenic
1023225144 7:37961293-37961315 CAGTAAAAGCAGGAGGTGGCTGG - Intronic
1023648218 7:42341441-42341463 CAGAAAAAGGATAAGGAAGAAGG - Intergenic
1024227488 7:47337160-47337182 GAGCAAAAGGATCTGGTGGATGG - Intronic
1028088800 7:86671851-86671873 CAGTAAATGGATAAGGAGACTGG - Intronic
1029112255 7:98218310-98218332 CAGAAAGAGGATCAGGAGGCCGG - Intronic
1029314576 7:99699752-99699774 CACCAAAATTAGAAGGTGGCTGG + Intronic
1029782280 7:102747487-102747509 CACCAAAAGAATAAGGAGGGAGG + Intergenic
1031253377 7:119415970-119415992 CAGCACAAGGATTAGTTAGCAGG - Intergenic
1031554588 7:123156886-123156908 CAGCAAAATGATAAGCCTGCTGG - Intronic
1031750242 7:125562709-125562731 CAGCAATAGAAGAAGGTGGTGGG + Intergenic
1032298729 7:130668176-130668198 CAGGAAAACGATAAGGTACCAGG + Intronic
1034185124 7:149169905-149169927 CAGCAAAGGGAAAAGGTACCTGG + Intronic
1036185244 8:6616945-6616967 CTGCAAGCAGATAAGGTGGCAGG - Intronic
1037440356 8:18909947-18909969 CAGCGAAAGGAAAAAGTGGCAGG + Intronic
1039124004 8:34180378-34180400 CAGCAAAAGGAACAGTTAGCAGG + Intergenic
1039802432 8:40970887-40970909 CAGGAAGAAGATAAGGTGGAAGG - Intergenic
1041523822 8:58784020-58784042 CAGCAAAAACAACAGGTGGCAGG + Intergenic
1041819362 8:62012284-62012306 CGGCAGAAGGCTAAGGTGGGAGG + Intergenic
1042732459 8:71952153-71952175 CAGTGAAAGGATAAGCTGGATGG - Intronic
1044337788 8:91008037-91008059 CAGCAAAAGGAAAAGGCAGATGG - Intronic
1045801418 8:106105580-106105602 CATCAAAACGTTATGGTGGCAGG + Intergenic
1048026540 8:130592399-130592421 CAGCAAAGGGACCAAGTGGCAGG - Intergenic
1048078086 8:131095210-131095232 CATCAAGAAGTTAAGGTGGCCGG + Intergenic
1048371103 8:133776867-133776889 AAGCACAAGGATAATTTGGCAGG - Intergenic
1050780574 9:9329185-9329207 CAGAAACAGGATAATATGGCTGG + Intronic
1051534334 9:18140364-18140386 CAGCAAAGGGAAAAGGTGTATGG + Intergenic
1051654326 9:19364020-19364042 GAAAAAAAGGATAATGTGGCTGG + Intronic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1052838820 9:33273454-33273476 CAGGAAAAGGATAATTAGGCAGG - Intronic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053076761 9:35140294-35140316 CATCAAAAGTATAAAGTGGAAGG + Intergenic
1053460184 9:38262681-38262703 CAGCAAAAGAAACAGGTGGCAGG + Intergenic
1055964391 9:81851301-81851323 CATCAAAAGGATAAGGCGACAGG - Intergenic
1056740713 9:89252156-89252178 CAGCAAAGGGTGAAGGTTGCTGG + Intergenic
1057580542 9:96283926-96283948 CAGTAAAAGTCTAAAGTGGCTGG + Intronic
1058478603 9:105367654-105367676 CTGCAAAAGCAAAAGGTGCCTGG - Intronic
1060607894 9:124933928-124933950 CAGCAAAGGGAAAAGGTGCATGG - Intronic
1061621353 9:131813220-131813242 CTGACAAAGGATGAGGTGGCAGG + Intergenic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186772521 X:12831742-12831764 CATCAAAAGGATAATGTGGCTGG - Intergenic
1186869500 X:13756507-13756529 CTGCAAAAGTAAAAGCTGGCAGG - Intronic
1187270831 X:17777799-17777821 CAGTATAAAGATAAGTTGGCTGG - Intergenic
1187501591 X:19843499-19843521 CACCAAAAGGAAAACGTGGCTGG - Intronic
1188010318 X:25048385-25048407 CAGCAAAAGGAACAGCTGCCTGG + Intergenic
1188736539 X:33724392-33724414 CAGCAAAAATATAATGTGGTGGG - Intergenic
1190295230 X:49022687-49022709 CAACAAAAGGCTGAGGTGGGAGG - Intergenic
1192263839 X:69525141-69525163 CAGTAACAGGCTATGGTGGCTGG - Intronic
1193550578 X:82887625-82887647 CAGCAAAAGCAAAAACTGGCGGG + Intergenic
1194700985 X:97113074-97113096 CACTAAAAGGAAAAAGTGGCCGG - Intronic
1195432384 X:104803930-104803952 CTGCAAGAGTAAAAGGTGGCAGG + Intronic
1196309646 X:114148586-114148608 AGGCAAAAGGAGATGGTGGCTGG + Intergenic
1197034151 X:121854184-121854206 CAGCAAAGTGATATGGTGGGTGG - Intergenic
1197798447 X:130322897-130322919 CAGCAAACGGAGAAGATGGCAGG - Intergenic
1198150180 X:133900631-133900653 CAACAAAATGATAAGGAGGAAGG + Intronic
1198162362 X:134020281-134020303 AAACAAAAGGATAAGCAGGCCGG + Intergenic
1201789619 Y:17825110-17825132 CTGCAAAAGTAAAAGCTGGCAGG - Intergenic
1201811934 Y:18080878-18080900 CTGCAAAAGTAAAAGCTGGCAGG + Intergenic
1202351272 Y:23994862-23994884 CTGCAAAAGTAAAAGCTGGCAGG - Intergenic
1202519507 Y:25675257-25675279 CTGCAAAAGTAAAAGCTGGCAGG + Intergenic