ID: 946192287

View in Genome Browser
Species Human (GRCh38)
Location 2:218013916-218013938
Sequence CAGGGCAAACTTGGGGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946192287_946192297 -6 Left 946192287 2:218013916-218013938 CCCTTCTCCCCAAGTTTGCCCTG No data
Right 946192297 2:218013933-218013955 GCCCTGGATCTGGGTTAGGAGGG No data
946192287_946192296 -7 Left 946192287 2:218013916-218013938 CCCTTCTCCCCAAGTTTGCCCTG No data
Right 946192296 2:218013932-218013954 TGCCCTGGATCTGGGTTAGGAGG No data
946192287_946192307 29 Left 946192287 2:218013916-218013938 CCCTTCTCCCCAAGTTTGCCCTG No data
Right 946192307 2:218013968-218013990 CCAGAGAAGCAAGAAAAGAATGG No data
946192287_946192295 -10 Left 946192287 2:218013916-218013938 CCCTTCTCCCCAAGTTTGCCCTG No data
Right 946192295 2:218013929-218013951 GTTTGCCCTGGATCTGGGTTAGG No data
946192287_946192308 30 Left 946192287 2:218013916-218013938 CCCTTCTCCCCAAGTTTGCCCTG No data
Right 946192308 2:218013969-218013991 CAGAGAAGCAAGAAAAGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946192287 Original CRISPR CAGGGCAAACTTGGGGAGAA GGG (reversed) Intergenic
No off target data available for this crispr